Question
3. Hedge Row Bank has the following balance sheet (in millions): $ 189 $210 Liabilities Assets...
3.
Hedge Row Bank has the following balance sheet (in millions): $ 189 $210 Liabilities Assets Equity 21 $ 210 $210 Total Total The duration of the assets is 7 years and the duration of the liabilities is 5 years. The bank is expecting interest rates to fall from 10 percent to 9 percent over the next year. a. What is the duration gap for Hedge Row Bank? (Round your answer to 2 decimal places. (e.g., 32.16)) b. What is the expected change in net worth for Hedge Row Bank if the forecast is accurate? (Enter your answer in millions rounded to 3 decimal places. (e.g., 32.161)) c. What will be the effect on net worth if interest rates increase 100 basis points? (Negative amount should be indicated by a minus sign. Enter your answer in millions rounded to 3 decimal places. (e.g., 32.161)) d. If the existing interest rate on the liabilities is 6 percent and that on the assets is 10 percent, what will be the effect on net worth of a 1 percent increase in interest rates? (Negative amount should be indicated by a minus sign. Do not round intermediate calculations. Enter your answer in millions rounded to 4 decimal places. (e.g., 32.1616)) Duration gap years а. million Expected change in net worth b. Expected change in net worth million C. Expected change in net worth d. million OO
Answers
Solution:
a Duration Gap 2.5 years b Expected Change in net worth $4.773 million c Expected Change in net worth -$4.773 million d Expected Change in net worth - $4.4485 million a) Duration Gap (DGAP) = Duration of assets - (market value of liabilities / market value of assets) x Duration of liability
= 7 - (189/210) x 5
= 2.5 years
b) Expected change in net worth= -DGAP [change in interest rates/(1+ R)] x market value of asset
= -2.5(-0.01/1.1) $ 210
= $4.773 million
c) Expected change in net worth= -DGAP [change in interest rates/(1+ R)] x market value of asset
= -2.5(0.01/1.1) $ 210
= -$4.773 million
d) We need to find the impact on equity of a change in interest rates in both assets and liabilities.We find this by determining difference between the change in interest rates of assets and liabilities.
Expected change in net worth= Change in Asset Value - Change in Liabilities value
Change in Asset Value = -Duration of assets [change in interest rate of assets/(1+ R(a))] x market value of asset
= -7 x [.01/1.1] x $210
= -$13.36363623 million
Change in Liabilities value= - Duration of Liabilities [change in interest rates of liabilities/(1+ R(L)] x market value of liabilities
= -5 x [0.01/1.06] x $189
= -$ 8.915094279 million
Expected change in net worth= -$13.36363623 - (-$ 8.915094279)
= - $4.4485 million
Similar Solved Questions
1 answers
Spring Problem
A 1.50 kg object slides to the righton a surface having a coefficient of kinetic friction 0.250 (Fig.P7.54). The object has a speed of vi=3.40 m/s when it makes contact with alight spring that has a force constant of 50.0 N/m. The objectcomes to rest after the spring has been compressed adistanced. ...
1 answers
Each wire PO and PN are the same except for their lengths. MN is a rigid...
Each wire PO and PN are the same except for their lengths. MN is a rigid bar and is free to rotate about Point M. Must include free-body diagram and sketches used to obtain equations of equilibrium and compatibility. Show all work to receive full credit. a M rigid bar o N pin support 2a a F a. Deriv...
1 answers
CHM 202F19 HW 9B Name Answer the q. in the spaces below. Use the back of...
CHM 202F19 HW 9B Name Answer the q. in the spaces below. Use the back of the page if necessary. 1. Give the conjugate bases for the following Bronsted-Lowry acids: a) H2SO4 b) HNO; CHO DOH e) HPO4 Ansa) b) c) d) 2. Give the conjugate acids for the following Bronsted-Lowry bases: a) 0,2 b) HPO4? c) H...
1 answers
Please answer all parts Q1 A school found that 78 out of a random sample of...
please answer all parts Q1 A school found that 78 out of a random sample of 100 students had read a book in a month. (a) Find a 96% confidence interval for the proportion in the corresponding population. (b) The school has decided that a more precise estimate is needed and wishes to reduce the width...
1 answers
What are the characteristics of the simple harmonic motion on a spring?
What are the characteristics of the simple harmonic motion on a spring?...
1 answers
Using the method of joints, determine the force in each member of the truss shown.
Using the method of joints, determine the force in each member of the truss shown....
1 answers
A beam of partially polarized light can be considered to be a mixture of polarized and...
A beam of partially polarized light can be considered to be a mixture of polarized and unpolarized light. Suppose we send such a beam through a polarizing filter and then rotate the filter through 360 degrees while keeping it perpendicular to the beam. If the transmitted intensity varies by a factor...
1 answers
24. Circle all conditions favored by the Hardy-Weinberg Equilibrium Concept. If none applies circle F A....
24. Circle all conditions favored by the Hardy-Weinberg Equilibrium Concept. If none applies circle F A. Gene Flow B. Genetic Drift 25. Circle the evolutionary process in which one species obtains a gene from another species. E, Random Mating F. Not Listed C. Mutations D. Natural Selection If none a...
1 answers
Problem 1: For the following centrifugal pump parameters determine (a) the manometric efficiency 5 points] and...
Problem 1: For the following centrifugal pump parameters determine (a) the manometric efficiency 5 points] and (b) the fraction of total energy converted into pressure energy by the impeller of a centrifugal pump [5 points]. Impeller diameter: 0.1 m Impeller rotational speed: 1000 rpm The differenti...
1 answers
C programming Write an iterative and recursive version of a function to print out a linked...
C programming Write an iterative and recursive version of a function to print out a linked list from head to tail and then do the same for printing a linked list from tail to head. Assume a singly linked list in all cases and access only to a head pointer at the time of the function call. struct no...
1 answers
Q66 A manager who utilizes the Achievement-Oriented leadership style will likely _____. [1 Mark]
Q66 A manager who utilizes the Achievement-Oriented leadership style will likely _____. [1 Mark]...
1 answers
CHAPTER 14: Using the restriction enzyme indicated, predict HOW MANY fragments will result after using that...
CHAPTER 14: Using the restriction enzyme indicated, predict HOW MANY fragments will result after using that enzyme to cut the DNA. Cut the DNA using Ddel 5' - TAGAGATCATTAATCCGGTGATCCAGGATTAATAGATCACTAG - 3' EcoR I recognizes the sequence 5²-ATT AAT-3' Hind III recognizes the sequen...
1 answers
What is the second derivative of #f(x)=-cot^2x #?
What is the second derivative of #f(x)=-cot^2x #?...
1 answers
11. Why do researchers suspect that Sahelanthropus was more likely a human ancestor, and not an a...
11. Why do researchers suspect that Sahelanthropus was more likely a human ancestor, and not an ape ancestor? 12. Until quite recently, aprominent hypothesisin the origin of humans was that bipedalism and increased brainsizeevolved simultaneously. What evidence is calling this hypothesis into questi...
1 answers
All wedding photographs are paid for in advance. During the year, Bartow received $12,600 for wedding...
All wedding photographs are paid for in advance. During the year, Bartow received $12,600 for wedding photographs. At year end, $37,400 of services had been performed, Account Names DR CR Show any necessary calculations Mark for Review What's This? acer...
1 answers
B P . The Sunne two large molecular groups A and B can react to form...
B P . The Sunne two large molecular groups A and B can react to form a macromolecule P. in the reaction A quilibrium constant for the reaction is ke/co, where he 3 and UM Initially, the concentration of molecular group A is A-0.1 M, the concentration of molecular croup B is B 02 M and the concentrat...
1 answers
1-4 please help 7 points possible Last Name First Name 1 x 1031. It dissociates in water The slightly soluble salt...
1-4 please help 7 points possible Last Name First Name 1 x 1031. It dissociates in water The slightly soluble salt fluorapatite, Cas(POa)3F, has a Ksp according to the following equation: Cas(PO4)3Fi 5Ca2 3PO F 1. Write the Ksp equation for this process: Ksp Calculate the equilibrium concentrati...