1

The following is a DNA sequencing gel where the different dideoxynucleotides have fluorescent labels that cause...

Question

The following is a DNA sequencing gel where the different dideoxynucleotides have fluorescent labels that cause...

The following is a DNA sequencing gel where the different dideoxynucleotides have fluorescent labels that cause them to emit

Select one: O a. 3GACAAGCTTCGTACCAACAGGTCT 5 O O O b.5 CTGTTCGAAGCATGGTTGTCCAGA 3 C3 CTGTTCGAAGCATGGTTGTCCAGA 5 d. 5GAC

The following is a DNA sequencing gel where the different dideoxynucleotides have fluorescent labels that cause them to emit a different colour. In this case A = red/triangle, T = green, G = purple/circle and C = black. Based on the image of the gel, what was the sequence of synthesized strand? (The top of the gel is where the DNA was loaded - the negatively charged end) IDOL O III ODDITIO
Select one: O a. 3'GACAAGCTTCGTACCAACAGGTCT 5' O O O b.5' CTGTTCGAAGCATGGTTGTCCAGA 3 C3' CTGTTCGAAGCATGGTTGTCCAGA 5' d. 5'GACAAGCTTCGTACCAACAGGTCT 3' e. none of the other answers are correct

Answers

Option b

DNA sequencing is the procedure of determining the sequence of the nucleic acid. A method or technique that determines the order of the four bases: adenine, guanine, cytosine, and thymine. The major sequencing methods employed are- Maxam Gilbert sequencing and Sanger sequencing/chain termination method (Here dideoxynucleotides are incorporated by the DNA polymerase during the process of replication in vitro.). Nowadays, automated sequencing is used.

In the given gel the base A is denoted by red/triangle

G=purple/circle

C=Black

T=Green

The direction of electrophoresis will be from negative electrode (as DNA is negatively charged) to the positive electrode, i.e, from top of the gel to the bottom of the gel. The resulting sequence will be read from bottom to top direction or 5’ to 3’ direction.

The sequence will be as given in option b.


Similar Solved Questions

9 answers
What are the short term effects of Cocaine: When someone consumes this substance what effect will it have on their body, mind, and behavior
What are the short term effects of Cocaine: When someone consumes this substance what effect will it have on their body, mind, and behavior?Please answer ASAP I really need the answer... and please don't give the website for me to find the info, I don't have enough time to do so.. So please ...
1 answers
4 NH3(g) +50,(9) — 4NO(g) + 6H20(9) how many molecules of H, O can be formed...
4 NH3(g) +50,(9) — 4NO(g) + 6H20(9) how many molecules of H, O can be formed from 3.78 mol O,?...
1 answers
2) A put option is priced at $4 with an exercise price of $60 and an...
2) A put option is priced at $4 with an exercise price of $60 and an underlying price of $62. Determine the following: o Option value for a long position if the stock price at expiry is $62 Profit for the long position if the stock price at expiry is $55 • What is the breakeven stock price at e...
1 answers
(a) Started business by Issuing 10,000 shares of common stock for $27,000 (b) Hired Rebecca as...
(a) Started business by Issuing 10,000 shares of common stock for $27,000 (b) Hired Rebecca as an administrative assistant, promising to pay her $2,200 every two weeks. (c) Rented a building for three years at $510 per month and paid six months' rent in advance. (d) Purchased equipment for $5,90...
1 answers
Applying Factory Overhead Jernigan Company estimates that total factory overhead costs will be $68,000 for the...
Applying Factory Overhead Jernigan Company estimates that total factory overhead costs will be $68,000 for the year. Direct labor hours are estimated to be 17,000. a. For Jernigan Company, determine the predetermined factory overhead rate using direct labor hours as the activity base. If required, r...
1 answers
2. Explain the various types of hormo ne various types of hormonal method of contraception.
2. Explain the various types of hormo ne various types of hormonal method of contraception....
1 answers
Linear Regression The owner of a pizzeria wishes to build a model relating revenues to advertising...
Linear Regression The owner of a pizzeria wishes to build a model relating revenues to advertising expenditures into three categories: television, newspaper and direct mailing advertising Summary Output Regression Stotistics 0.967 0.94 0.887 0.64 Multiole R R Square Aduisted R Square tandard Eo Obse...
1 answers
6(2-1) 4 -+3 182 144(1 - z2) (r2 +3)2 Sketch the graph of eah of the...
6(2-1) 4 -+3 182 144(1 - z2) (r2 +3)2 Sketch the graph of eah of the following, giving intercepts, asymptotes, where increasing. where decreasing, any relative maximum and relative minimum points, where concave upward, where concave downward, and any inflection points...
1 answers
Exercise Help Save &Exit Submit The beginning capital balance shown on a statement of owner's equity...
Exercise Help Save &Exit Submit The beginning capital balance shown on a statement of owner's equity is $66,000 Net income for the period is $19,000 and the owner withdrew $23,000 cash from the business and made no additional investments during the period. The owner's capital balance at ...
1 answers
Discusses different areas that currently make up the field of Recreation . Select 1 of the...
discusses different areas that currently make up the field of Recreation . Select 1 of the areas that you would be interested in working and address these questions: What type of job you would like to perform, and why? What sort of daily activities would this job require? What credentials would you...
1 answers
. Draw shear and meme t diagram, the ve hanging beam 15k IF ら 201 A.
. Draw shear and meme t diagram, the ve hanging beam 15k IF ら 201 A....
1 answers
O Price and cost (thousands of dollars per hour) The figure shows the market for college...
o Price and cost (thousands of dollars per hour) The figure shows the market for college education in the United States. If there is no external benefit from a college education and the government does not intervene in the market, then the equilibrium tuition of college education is 20 S=MC 18 A. $1...
1 answers
Need help solving these: Caspian Sea Drinks is considering buying the J-Mix 2000. It will allow...
Need help solving these: Caspian Sea Drinks is considering buying the J-Mix 2000. It will allow them to make and sell more product. The machine cost $1.60 million and create incremental cash flows of $591,135.00 each year for the next five years. The cost of capital is 11.13%. What is the internal r...
1 answers
Telecommuting at MedEx Harry Davis just finished interviewing a candidate to fill another medical...
Telecommuting at MedEx Harry Davis just finished interviewing a candidate to fill another medical billing specialist opening. As the human resources manager for MedEx, a medical billing company, Harry is concerned about the high turnover rate for the specialists. Turnover is very costly for the comp...
1 answers
Classify each of the molecules given below as polar or nonpolar. BrCI NH, HO CH, so,...
Classify each of the molecules given below as polar or nonpolar. BrCI NH, HO CH, so, CS XeF, co, OF, PF, so, XeF, SF, SF, Polar Nonpolar...
1 answers
Exercise 2.2 The gift shop of the Frisian Museum uses the following ledger accounts: Equipment Accounts...
Exercise 2.2 The gift shop of the Frisian Museum uses the following ledger accounts: Equipment Accounts receivable Inventory Cash Depreciation expenses Long term loan Rent Gross profit Interest expenses Accounts payable During the month of April 2013 de following financial facts occurred: 1/4 Purcha...
1 answers
20. Refer to Table 13-3. Gallo's cork factory experiences diminishing marginal product of labor with the additio...
20. Refer to Table 13-3. Gallo's cork factory experiences diminishing marginal product of labor with the addition of which worker? a. The third worker. b. The fourth worker. c. The fifth worker. d. The sixth worker. Average total cost equals a. 21. change in total costs divided by quantity produ...
1 answers
Finish the following requirements given the below information Homework: CH4 Save Score: 0 of 5 pts...
finish the following requirements given the below information Homework: CH4 Save Score: 0 of 5 pts 5 of 6 (0 complete) HW Score: 0%, 0 of 30 pts E4-25A (book/static) Question Help Several years after reengineering its production process. Dettling Corporation hired a new controller, Alana Metzgar. (...

-- 0.039729--