Question
A flask with a volume of 3.16 L contains 9.33 g of an unknown gas at...
A flask with a volume of 3.16 L contains 9.33 g of an unknown gas at 32.0°C and 1.00 atm. What is the molar mass of the gas? (R = 0.08206 L • atm/K • mol) Multiple Choice 18 Ο 776 g/mol Ο 144 g/mol Ο 66.1 g/mol Ο 739 g/mol Ο 81.4 g/mol
Answers
Solution:
By using Ideal gas equation, molar mass of the gas is 73.9g/mol. So, correct option is (d) 73.9g/mol, other options are not correct.
Hope, it helps. :)
Solution! AS Ideal Gas equation, PV = nRT where, P= Press are of gas v = volume of the gas n= no ob moles R=0.08206 Latm k mol. - Cuniversal Gias constant) T = Temperature Given, p=1.00 atm , v= 3.16L. W (Given = 9.33g TCR)= 32.0+273-15 - mass of gas) = 305.15 R. Putting all values in Ideal gas equation so n = 1.000 3.16 0.08206× 305.15 = 10-126 mol Now, as n (no of moles) = Given mass malar mass Molar mass = Given mass no of moles Molar mass of gas = 9.33 0:1261 = 79.9 g/mol Hence, molar mass of gas = 73.9g mal] Correct and (d) 79.9 g/mol
Similar Solved Questions
1 answers
The following amide is synthesized from an acid chloride via nucleophilic acyl substitution. Draw the two...
The following amide is synthesized from an acid chloride via nucleophilic acyl substitution. Draw the two neutral organic starting materials needed to synthesize the amide. . H3C CH3 H...
1 answers
3, (8 points) (Like 2.88) In a relay race, runner #1 (already in motion) must hand...
3, (8 points) (Like 2.88) In a relay race, runner #1 (already in motion) must hand a baton to runner #2 (who is waiting as runner #1 completes the first part of the race). Runner #1 is moving at a constant speed v 8.47 m/s. Runner #2 begins from rest, and has a constant acceleration of a: 2.97 m/s. ...
1 answers
Which of the following statements about the Dividends account is correct? It has a credit balance....
Which of the following statements about the Dividends account is correct? It has a credit balance. It is an expense. It reduces Retained Earnings. It is an account that is reported only on the income statement....
1 answers
Explain the purpose of the ICD Dash 10 Dash CM official guidelines for coding and reporting
explain the purpose of the ICD Dash 10 Dash CM official guidelines for coding and reporting...
1 answers
Talk About It 1: How can crowdsourcing help managers make better decisions? Talk About It 2:...
Talk About It 1: How can crowdsourcing help managers make better decisions? Talk About It 2: What are some risks in using crowdsourcing to make decisions?...
1 answers
Question 1. Give an example of a complete metric space (X, d) and a function f...
Question 1. Give an example of a complete metric space (X, d) and a function f :X + X such that d(f(x), f(y)) < d(x, y) for all x, y E X with x + y and yet f does not have a fixed point. a map f:X + X has a fixed point if there is an element a E X such that f(a) = a....
1 answers
You are the manager of a restaurant for a fast-food franchise. Last month, the mean waiting...
You are the manager of a restaurant for a fast-food franchise. Last month, the mean waiting time at the drive-through window for branches in your geographical region, as measured from the time a customer places an order until the time the customer receives the order, was 3.7 minutes. You select a ra...
1 answers
Time (s) 5 Velocity 10 20 15 25 - -2 ☺ -3 -4 -5 A G...
Time (s) 5 Velocity 10 20 15 25 - -2 ☺ -3 -4 -5 A G The graph below shows the velocity vs time information for a bus traveling in a single dimension. For which segments of the graph is the bus slowing down? There may be more than one correct answer. Select all correct answers for full credit. ...
1 answers
2 3 -6 9 0 1 -2 0 3. Let A= 2 -4 7 2 The...
2 3 -6 9 0 1 -2 0 3. Let A= 2 -4 7 2 The RREF of A iso 0 1 3 -6 6 -6 0 0 0 (a) (6 points) Find a basis for Col A, the column space of A. 0 (b) (2 points) What is rank A? (c) (6 points) Find a basis for Null A, the null space of A. (d) (2 points) What is the dimension of the null space of A?...
1 answers
All of the following coordination problems were present in the forecast-sharing game EXCEPT lack of trust...
All of the following coordination problems were present in the forecast-sharing game EXCEPT lack of trust and trustworthiness operational obstacles like lead times and MOQs local optimization A hospital stocks two surgical supplies on a continuous review basis. Both are replenished on average every ...
1 answers
All firms in a competitive industry have the following long-run total cost curve: where q is...
All firms in a competitive industry have the following long-run total cost curve: where q is the output of the firm. a. Compute the long run equilibrium price and explain how you obtain the result [20 marks] b. Suppose the market demand is given byp 10- Q. Determine the long-run equilibrium number o...
1 answers
2 Suppose you are given $600 and decide to put it into a savings account. At the end of each year...
2 Suppose you are given $600 and decide to put it into a savings account. At the end of each year the amount either increases by $400 (with probability 0.75) or decreases by $200 (with probability 0.25). Suppose that if it ever reaches 0, then S200 is immediately paid into the account (so the next y...
1 answers
How many carbon signals would each of the following molecules produce? How many carbon signals would...
How many carbon signals would each of the following molecules produce? How many carbon signals would each of the following molecules produce?...
1 answers
Introduction to clinical pharmacology study guide chapter 3 chapter 3 ACROSS 3. Drug that may replace...
introduction to clinical pharmacology study guide chapter 3 chapter 3 ACROSS 3. Drug that may replace another drug at a receptor site, decreasing the effect of the first drug 6. What the drug does to the body 9. The use of drugs in the treatment of disease DOWI 1. Pro 2. Rei or 4. Pre ar...
1 answers
Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA...
Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA fragment. Which of the two strands could be used as a template for transcription? Once translated, how many aminoacids would be produced? 5' - ATTGGCCGATATAAACGTACTAATGCCCAGCCGAATTGTAATCCATTGACCC -31 3'...
1 answers
Path: P Words:0 QUESTION 27 A 42.9 g sample of Fe (specific heat 0.449 J/gºC) at...
Path: P Words:0 QUESTION 27 A 42.9 g sample of Fe (specific heat 0.449 J/gºC) at an initial temperature of 125.0°C is added to 185.0 g sample of water. The final temperature reached for both is 42.1°C. Assuming no heat is lost to the surroundings and given that the specific heat of wate...
1 answers
A firm has a production function of Q=20K^.2*L^.8 where Q measures output, K represents machine hours,...
A firm has a production function of Q=20K^.2*L^.8 where Q measures output, K represents machine hours, and L measures labor hours. If the rental cost of capital (r) equals $15 the wage rate (w) equals $10, and the firm wants to produce 40,000 units of output, how much labor and capital should the fi...