1

Remaining Time: 59 minutes, 50 seconds. Question Completion Status: QUESTION 1 Zintel, a telecommunication company located...

Question

Remaining Time: 59 minutes, 50 seconds. Question Completion Status: QUESTION 1 Zintel, a telecommunication company located...

Remaining Time: 59 minutes, 50 seconds. Question Completion Status: QUESTION 1 Zintel, a telecommunication company located in
Remaining Time: 59 minutes, 50 seconds. Question Completion Status: QUESTION 1 Zintel, a telecommunication company located in South America manufactures Micro Chips for Smart F operations data were as follows: Units in beginning inventory 10 Units produced 10,000 Units sold 8,000 Selling price per unit $120 tive expenses: Selling & Adminis Variable per unit Fixed (total) $8 $30,000 Manufacturing costs: Direct materials cost per unit Direct labor cost per unit Variable manufacturing overhead cost per unit Fixed manufacturing overhead (total) $50 $32 $10 $110,000 Required: a. Calculate the unit product cost using the variable costing method. b. Prepare an income statement using the variable costing method. C. Calculate the unit product cost using the Absorption costing method d. Prepare an income statement using the Absorption costing method e. Calculate and explain the difference in the reported net operating income between the above me Click Save and Submit to save and submit. Click Save All Answers to save all answers.

Answers

a. Computation of unit product cost under Variable costing method:

$
Direct materials cost per unit $50
Direct labor cost per unit 32
Variable manufacturing overhead per unit 10
Unit product cost under variable costing $92

Unit Product cost under Variable Costing = $92 per unit

b. Statement showing the income statement using the variable costing method:

Variable Costing Income Statement
$ $
Sales (8,000 * $120) $960,000
Less: Variable Cost of Goods Sold
      Variable Cost of Goods Manufactured (10,000 units * $92) $920,000
      (-) Ending Inventory (2,000 units * $92) $184,000 $736,000
Gross Contribution Margin ($960,000 - $736,000) $224,000
Less: Variable Selling and Administrative Expense (8,000 * $8) $64,000
Contribution Margin ($224,000 - $64,000) $160,000
Less: Period Expenses:
      Fixed Manufacturing Overhead $110,000
      Fixed Selling and Administrative Expense $30,000 $140,000
Net Opearating income ($160,000 - $140,000) $20,000

c. Computation of unit product cost under Absorption costing method:

Fixed manufacturing overhead per unit = Fixed manufacturing overhead / Units Produced

= $110,000 / 10,000 units = $11 per unit

$
Direct materials cost per unit $50
Direct labor cost per unit 32
Variable manufacturing overhead per unit 10
Fixed manufacturing overhead per unit 11
Unit product cost under Absorption costing $103

Unit Product cost under Absorption Costing = $103 per unit

b. Statement showing the income statement using the Absorption costing method:

Absorption Costing Income Statement
$ $
Sales (8,000 * $120) $960,000
Less: Variable Cost of Goods Sold
      Cost of Goods Manufactured (10,000 units * $103) $1,03,0000
      (-) Ending Inventory (2,000 units * $103) $206,000 $824,000
Gross Profit ($960,000 - $824,000) $136,000
Less: Selling and Administrative Expense
      Variable Selling and Administrative Expense (8,000 * $8) $64,000
      Fixed Selling and Administrative Expense $30,000 $94,000
Net Opearating income ($136,000 - $94,000) $42,000

d. Reconsiliation Statement:

$
Net operating income under Absorption costing $42,000
Net operating income under Variable costing $20,000
Difference in Net operating income ($42,000 - $20,000) $22,000
Change in inventory (10,000 units - 8,000 units) 2,000 units
Fixed manufacturing overhead deferred in inventory (2,000 units * $11) $22,000


Similar Solved Questions

1 answers
What is the number of colorings?
Robert colors each square in an empty 3 by 3 grid either red or green. Find the number of colorings such that no row or column contains more than one green square....
1 answers
Question 5 (a) Given the following spectroscopic data, identify and draw the compound. Explain your reasoning...
Question 5 (a) Given the following spectroscopic data, identify and draw the compound. Explain your reasoning i. ii. MS molecular ion: 102 'H NMR peaks a. 1.15 t (3H) b. 1.25 (3H) c. 2.35q (2H) d. 4.159 (2H) [Marks: 4] (b) For 1-cyclohexyl-eth-1-ene, sketch and label the: Infrared spectrum ii. 3...
1 answers
Determine the odd primes p for which −26 is a square mod p
Determine the odd primes p for which −26 is a square mod p...
1 answers
What do opponents of CISA feel are the drawbacks or problems with such legislation? What are...
What do opponents of CISA feel are the drawbacks or problems with such legislation? What are your views?...
1 answers
A boxcar of length 10.1 m and height 2.4 m is at rest on frictionless rails....
A boxcar of length 10.1 m and height 2.4 m is at rest on frictionless rails. Inside the boxcar (whose mass when empty is 3900 kg) a tank containing 1800 kg of water is located at the left end. The tank is 1.0 m long and 2.4 m tall. At some point the walls of the tank start to leak, and the water fil...
1 answers
Augu Q46. Below is a DNA sequence from a yeast GPCR gene. Using RNA sequencing methods...
Augu Q46. Below is a DNA sequence from a yeast GPCR gene. Using RNA sequencing methods you have obtained the following partial 5' sequence for the MRNA transcribed from this gene: 5'-GGUCCAU... 5'GTATAAGAAGCACTCTACCTCAATGGGTCCATGGGAGAAGGTAGGCATGTGTATTTGACAAAGGGA i. What are the most like...
1 answers
Lab 10C - Creating a new class This assignment assumes that you have read and understood...
Lab 10C - Creating a new class This assignment assumes that you have read and understood the following documents: http://www.annedawson.net/Python3_Intro_OOP.pdf http://www.annedawson.net/Python3_Prog_OOP.pdf and that you're familiar with the following example programs: http://www.annedawson.ne...
1 answers
Soils maybe separated into three very board categories. which of the following is not one of...
Soils maybe separated into three very board categories. which of the following is not one of these. cohesionless, plasmic, organic, or cohesive....
1 answers
DISSONANCE BETWEEN EMPLOYEES Matt created his T-shirt business, T’d up, 30 years ago, building the company...
DISSONANCE BETWEEN EMPLOYEES Matt created his T-shirt business, T’d up, 30 years ago, building the company up from a small, no-name brand that he ran out of his parents’ garage while he was in school into a well-known local company that supplies custom T-shirts and other clothing and acc...
1 answers
How do you solve #(x^2+5x)/(x-3)>=0# using a sign chart?
How do you solve #(x^2+5x)/(x-3)>=0# using a sign chart?...
1 answers
TThis is all the information given in the problem. There is a solution of a similar...
TThis is all the information given in the problem. There is a solution of a similar problem in the notes for the class and the values are just changed. 3) Determine the tension in each segment of the cable shown below. A E Чр B 15m р B C YKN SKM 18 КМ .am 1-3m 3. . &bul...
1 answers
Historically, what alternative was found that reduced the dependency on coal? Tidal Flow Wind Power Petroleum...
Historically, what alternative was found that reduced the dependency on coal? Tidal Flow Wind Power Petroleum Solar Panels...
1 answers
Macro Company has the following adjusted accounts and balances at June 30: Macro Company has the...
Macro Company has the following adjusted accounts and balances at June 30: Macro Company has the following adjusted accounts and balances at June 30: Accounts Payable Accounts Receivable Accumulated Amortization Accumulated Depreciation Cash Common Stock Deferred Revenue Depreciation Expense Equipme...
1 answers
Using the Tsai-Wu failure criterion for pure shear loading of a lamina at 45° to the...
Using the Tsai-Wu failure criterion for pure shear loading of a lamina at 45° to the fiber direction, express the shear stress at failure τ-F, in terms of the Tsai-Wu coefficients (Fig. P6.27). Then, obtain an approximate expression when Fit > Fe > Fe > Fr 6.27...
1 answers
Onlulast equation(d), İtdidn' tansw er, thesizeo f Dewar ray?
onlulast equation(d), İtdidn' tansw er, thesizeo f Dewar ray?...
1 answers
P5. (20points) Using a type J thermocouple to measure temperature and a reference bath exposed to...
P5. (20points) Using a type J thermocouple to measure temperature and a reference bath exposed to the ambient temperature of 20° C. What is the junction temperature if the voltmeter reads 8.714mv? P5. (20points) Using a type J thermocouple to measure temperature and a reference bath exposed to ...
1 answers
PART A 1. Based on your observations, which is the stronger oxidizing agent, chlorine (bleach) or...
PART A 1. Based on your observations, which is the stronger oxidizing agent, chlorine (bleach) or iodine? Provide a one-sentence reason why your answer follows from your observation. 2. a. Predict whether NaOBr would be able to oxidize I to iodine (I) or whether, rather, I would oxidize Br to Br+. b...
1 answers
1. The experiment's Standard 1 consists of 0.54 M CuSO4. What will be the concentration of...
1. The experiment's Standard 1 consists of 0.54 M CuSO4. What will be the concentration of Standard 2 if it is prepared by combining 10.0 mL of Standard 1 with 10.0 mL deionized water? 2. A student makes a solution for analysis by mixing 5.47 grams of Cu2SO4 into 408.2 grams of water. The densit...
1 answers
[The following information applies to the questions displayed below. Sedona Company set the following standard costs...
[The following information applies to the questions displayed below. Sedona Company set the following standard costs for one unit of its product for this year. Direct material (15 Ibs. @ $4.20 per Ib.) Direct labor (10 hrs. $6.40 per hr.) Variable overhead (10 hrs. @ $3.70 per hr.) Fixed overhead (1...
1 answers
Could u please give me the answer plz a)e A continuous-time closed-loop system is described by the block diagram shown...
Could u please give me the answer plz a)e A continuous-time closed-loop system is described by the block diagram shown ρ in Figure 2. 1- Figure 2v i)-suggest a sensible minimum time constant τ for the sensor dynamics shown in Figure 2 if the closed-loop bandwidth required is 10 rads. Use thi...

-- 0.012736--