1. What is the difference between Phenotype and Genotype of bacteria? Phenotype characteristics Genotype characteristics 2....

1) The genotype of bacteria is the heritable genes that are passed from the parents to the offsprings in the next generation. These genes that are inherited help in shaping the physical characteristics of the bacteria.  The phenotype is the physical characteristic of the bacteria that is caused due to the genetic make up of the bacteria or the genotype of the bacteria. Pheotype is the visible characteristics of the organism or the bacteria.

2)

Steps	Temperature	Time	Cycles
Initial denaturation	950C	10min	1
Denaturation	950C	30sec	27
Annealing	550C	30-45sec
Extension	720C	60sec
Final extension	680C	5min	1

3) Four probable causes for such a PCR result are :

• Presence of non specific primer binding
• Master mix concentration not appropriate
• Annealing temperature and time limit was too long
• The target sequence was impure in some way

4A) Serial dilution is a process of stepwise dilution of the solution containing the bacterial cell culture. This serial dilution is done to increase the specificity and reduce the bacterial count from lawn to singe colonies. The microbiome extract when plated from the original solution, there will be a lawn of the cell growth which will make it harder to count. With increasing the dilution, the concentration of the bacterial cells will decrease and thus there will be more of single colonies that will be easier to extract and work with.

4B) The media prepared contains all the raw materials that were present in the containers. The media if plated as soon as prepared, there will be contamination and growth of unwanted microbes on the plate. Autoclaving the media is done to sterilize the media in order to ensure that no unnecessary microorganisms grow in the petri plate. The heat and pressure induced sterility method is done at a temperature of 121 °C.

5) The nucleotide sequence can be easily interpreted by the chromatogram that has a bit of baseline noise but the real peaks are clearly visible:

CACAATAAATACTTACTCTCCCCAG

P.S. try to post clear pictures for the questions. It was hard to analyse the PCR gel picture.