Calculate the gross profit rate and the profit margin.…

Calculate the gross profit rate and the profit margin.(Round answers to 1 decimal place, s. 15.2%)...

Suppose in its income statement for the year ended June 30, 2022, The Clorox Company reported the following condensed data (d

Net Sales Cost of Goods Sold 3000 1 Gross Proht 3000 Operating Expenses Salaries and Wages Expense 460 i Depreciation Expense

Loss on Disposal of Plant Assets 46 i Interest Expense 161 i 207 i Income Before Income Taxes 1465 Income Tax Expense 498 Net

Calculate the gross profit rate and the profit margin.(Round answers to 1 decimal place, s. 15.2%) Gross profit rate Profit margin

Suppose in its income statement for the year ended June 30, 2022, The Clorox Company reported the following condensed data (dollars in millions Salaries and wages expenses $460 Research and development expense 114 Depreciation expense 90 Income tax expense 498 Sales revenue 46 6,230 Loss on disposal of plant assets 161 Cost of goods sold Interest expense 3,000 Advertising expense 499 Rent expense Sales returns and allowances 230 Utilities expense Assume a tax rate of 34%. fal

Net Sales Cost of Goods Sold 3000 1 Gross Proht 3000 Operating Expenses Salaries and Wages Expense 460 i Depreciation Expense 90 i Advertising Expense 499 i Research and Development Expense 114 i Rent Expense 105 i Utilities Expense 60 i Total Operating Expenses Income From Operations Other Expenses and Losses

Loss on Disposal of Plant Assets 46 i Interest Expense 161 i 207 i Income Before Income Taxes 1465 Income Tax Expense 498 Net Income /(Loss)

Business Accounting

< Previous

Next >

Answers

Answer → Calculate the gross profit rate and the profit marging- Calculate th sate 50 % Gross profit rate Profit margin 16.1

> Gross profit rate = 000 - $3000) X loo $6000 Gross profitrate = ($3000 x 100 $6000 Gross profit rate = 50% profit margin =

< Previous

Next >

Similar Solved Questions

1 answers

Note: The equation 5.31 is Wiedemann-Franz law: Show that the Wiedemann-Franz coefficient L in the Drude...

Note: The equation 5.31 is Wiedemann-Franz law: Show that the Wiedemann-Franz coefficient L in the Drude model is indeed given by (5.31), that is, 35 1名し (5.32) k2 σ2e2 (5.31)...

1 answers

Exercise 20-7 (Part Level Submission) Riggs Company purchases sails and produces sailboats. It currently produces 1,210...

Exercise 20-7 (Part Level Submission) Riggs Company purchases sails and produces sailboats. It currently produces 1,210 sailboats per year, operating at normal capacity, which is about 80% of full capacity. Riggs purchases sails at $254 each, but the company is considering using the excess capacity ...

1 answers

Please help solve The main types of bacteria in the colon are: Select one: O a....

please help solve The main types of bacteria in the colon are: Select one: O a. obligate anaerobes O b. Obligate aerobes. O c. Facultative anaerobes: O d. Aero tolerant anaerobes: Supply the missing enzyme for the following reaction to occur. OH НО, OH "OH OH Glucose Select one: ...

1 answers

EO 7,987 FO 9,344 $36,000? 7. AO 4,262 BO 4,987 CO 5.834 DO 6,826 S pt...

EO 7,987 FO 9,344 $36,000? 7. AO 4,262 BO 4,987 CO 5.834 DO 6,826 S pt In 2019, X Company's profit function was 0.37R - $85,800, where R is revenue. In 2020, the relationship between reveme and variable costs will not change, but fixed costs will decrease by $18,018. Assuming a tax rate of 35%, ...

1 answers

If fourteen cards are dealt from the top of a well shuffled deck of cards one...

If fourteen cards are dealt from the top of a well shuffled deck of cards one after another without replacement, what is the chance that the top card is a heart?...

1 answers

Problem 2 Analyzing transactions and preparing financial statements Samy Samer started a new business and completed...

Problem 2 Analyzing transactions and preparing financial statements Samy Samer started a new business and completed these transactions during December. Dec. 1 Samy Samer transferred $65,000 cash from a personal savings account to a checking account in the name of Samer Electric. 2 The ...

1 answers

Question 39 3 pts 39. Which of the following is not a cost resulting from a...

Question 39 3 pts 39. Which of the following is not a cost resulting from a unit-level activity? The cost of sending monthly statements to customers. The per unit cost of packaging goods. The cost of electricity to power manufacturing equipment, The indirect cost of glue used on each product....

1 answers

How do you solve the differential #dy/dx=4x+(4x)/sqrt(16-x^2)#?

How do you solve the differential #dy/dx=4x+(4x)/sqrt(16-x^2)#?...

1 answers

Lab Report Questions (5 points total): In this experiment to amplify regions of 16S genes, you...

Lab Report Questions (5 points total): In this experiment to amplify regions of 16S genes, you are performing a PCR without added DNA? Why? If an amplified PCR product is detected in this reaction, describe an appropriate course of action for how you might proceed with your experiment....

1 answers

Find a polynomial function P of the lowest possible degree, having real coefficients, a leading coefficient...

Find a polynomial function P of the lowest possible degree, having real coefficients, a leading coefficient of 1, and with the given zeros. 2 + 3i. - 1 and 2 The polynomial of lowest degree is P(x) =...

1 answers

You deposit $3,000 in a retirement account today at 5.5% interest. How much more money will...

You deposit $3,000 in a retirement account today at 5.5% interest. How much more money will you have if you leave the money invested for forty-five years rather than forty years? Select one: A. $7,839.74 B. $7,714.91 C. $7,858.19 D. $7,799.08 E. $7,846.52...

1 answers

A vector s has initial point (-5,3) and terminal point (-1,2). Write s in the form...

A vector s has initial point (-5,3) and terminal point (-1,2). Write s in the form s= ai+bj. s = 0 x 5 ?...

1 answers

How do you find the period of #y=3sin(x-2pi/3)-2#?

How do you find the period of #y=3sin(x-2pi/3)-2#?...

1 answers

1. In 2014 the Center for Disease Control claimed 70.7% of American adults were overweight. The...

1. In 2014 the Center for Disease Control claimed 70.7% of American adults were overweight. The UCLA Carter for Health Policy Research reports that 46% of Californians are overweight. Assume the information came from a simple random sample of 500 people. Can we conclude a lower proportion of Califor...

1 answers

PLEASE ANSWER THE FOLLOWING: 8. A limited type of investigation most frequently stopping after id...

PLEASE ANSWER THE FOLLOWING: 8. A limited type of investigation most frequently stopping after identifying the system and process issues of an error is called hindsight bias. Question 8 options: A. True B. False 9. Which of the following is true about the findings of the Institute of Medicine Report...

1 answers

2 [Type text] 3. Using this strand of DNA: AATACCGATACGGGGCAACTAAA a. Create the complementary DNA strand...

2 [Type text] 3. Using this strand of DNA: AATACCGATACGGGGCAACTAAA a. Create the complementary DNA strand (1 pts.) b. Create the complementary mRNA strand (from the original strand) (2 pts) c. Create the protein (refer to Table 1 on page 3 as needed) (2 pts.)...

1 answers

Which of the following costs would a computer manufacturer include in manufacturing overhead? O The wages earned by com...

Which of the following costs would a computer manufacturer include in manufacturing overhead? O The wages earned by computer assemblers. O Depreciation on testing equipment. O The cost of the disk drives. O The cost of the memory chips. Waterway Industries reported the following year-end information...