Placeholder

5 answers
If a right-angled isosceles triangle right-angled at origin has $3 x+4 y=6$ as its base, then the area of the triangle is(A) 7(B) $frac{11}{25}$(C) $frac{36}{25}$(D) $frac{12}{25}$
If a right-angled isosceles triangle right-angled at origin has $3 x+4 y=6$ as its base, then the area of the triangle is (A) 7 (B) $frac{11}{25}$ (C) $frac{36}{25}$ (D) $frac{12}{25}$...
5 answers
The line $x+y=1$ meets $mathrm{x}$-axis at $A$ and $mathrm{y}$-axis at $B . P$ is the mid-point of $A B cdot P_{1}$ is the foot of the perpendicular from $P$ to $O A ; M_{1}$ is that from $P_{1}$ to $O P ; P_{2}$ is that from $M_{1}$ to $O A$ and so on. If $P_{n}$ denotes the foot of the $n$th perpendicular on $O A$ from $M_{n-1}$, then $O P_{n}$ is equal to(A) $frac{1}{2^{n}}$(B) $frac{1}{2^{n-1}}$(C) $frac{1}{2^{n-2}}$(D) none of these
The line $x+y=1$ meets $mathrm{x}$-axis at $A$ and $mathrm{y}$-axis at $B . P$ is the mid-point of $A B cdot P_{1}$ is the foot of the perpendicular from $P$ to $O A ; M_{1}$ is that from $P_{1}$ to $O P ; P_{2}$ is that from $M_{1}$ to $O A$ and so on. If $P_{n}$ denotes the foot of the $n$th perpe...
5 answers
The line $x+y=a$ meets $x$-axis at $A$. $A$ triangle $A M N$ is inscribed in the triangle $O A B, O$ being the origin with right angle at $N ; M$ and $N$ lie respectively on $O B$ and $A B$. If area of $riangle A M N$ is $frac{3}{8}$ of the area of triangle $O A B$, then $frac{A N}{B N}$ is equal to(A) 3(B) $frac{1}{3}$(C) 2(D) $frac{2}{3}$
The line $x+y=a$ meets $x$-axis at $A$. $A$ triangle $A M N$ is inscribed in the triangle $O A B, O$ being the origin with right angle at $N ; M$ and $N$ lie respectively on $O B$ and $A B$. If area of $ riangle A M N$ is $frac{3}{8}$ of the area of triangle $O A B$, then $frac{A N}{B N}$ is equal t...
5 answers
Let $S_{1}, S_{2}, ldots$ be squares such that for each $n geq 1$, the length of a side of $S_{n}$ equals the length of a diagonal of $S_{n+1}$. If the length of a side of $S_{1}$ is $10 mathrm{~cm}$, then for which of the following values of $n$ is the area of $S_{s}$ less than 1 square $mathrm{cm} ?$(A) 7(B) 8(C) 9(D) 10
Let $S_{1}, S_{2}, ldots$ be squares such that for each $n geq 1$, the length of a side of $S_{n}$ equals the length of a diagonal of $S_{n+1}$. If the length of a side of $S_{1}$ is $10 mathrm{~cm}$, then for which of the following values of $n$ is the area of $S_{s}$ less than 1 square $mathrm{cm}...
5 answers
A line which makes an acute angle $heta$ with the positive direction of $x$-axis is drawn through the point $P(3,4)$ to meet the line $x=6$ at $R$ and $y=8$ at $S$, then(A) $P R=3 sec heta$(B) $P S=4 operatorname{cosec} heta$(C) $P R+P S=frac{2(3 sin heta+4 cos heta)}{sin 2 heta}$(D) $frac{9}{(P R)^{2}}+frac{16}{(P S)^{2}}=1$
A line which makes an acute angle $ heta$ with the positive direction of $x$-axis is drawn through the point $P(3,4)$ to meet the line $x=6$ at $R$ and $y=8$ at $S$, then (A) $P R=3 sec heta$ (B) $P S=4 operatorname{cosec} heta$ (C) $P R+P S=frac{2(3 sin heta+4 cos heta)}{sin 2 heta}$ (D) $frac...
5 answers
Straight lines $3 x+4 y=5$ and $4 x-3 y=15$ intersect at $A$. Points $B$ and $C$ are choosen on these lines such that $A B=A C$. The equation of the line $B C$ passing through the point $(1,2)$ is(A) $x+7 y+13=0$(B) $x-7 y+13=0$(C) $7 x+y-9=0$(D) none of these
Straight lines $3 x+4 y=5$ and $4 x-3 y=15$ intersect at $A$. Points $B$ and $C$ are choosen on these lines such that $A B=A C$. The equation of the line $B C$ passing through the point $(1,2)$ is (A) $x+7 y+13=0$ (B) $x-7 y+13=0$ (C) $7 x+y-9=0$ (D) none of these...
5 answers
The equation of the straight line passing through the point $(4,5)$ and making equal angles with the two straight lines given by the equations $3 x-4 y-7=0$ and $12 x-5 y+6=0$, is(A) $9 x-7 y-1=0$(B) $9 x+7 y-1=0$(C) $7 x+9 y-73=0$(D) $7 x+9 y+73=0$
The equation of the straight line passing through the point $(4,5)$ and making equal angles with the two straight lines given by the equations $3 x-4 y-7=0$ and $12 x-5 y+6=0$, is (A) $9 x-7 y-1=0$ (B) $9 x+7 y-1=0$ (C) $7 x+9 y-73=0$ (D) $7 x+9 y+73=0$...
5 answers
Let the algebraic sum of the perpendicular distances from the points $A(2,0), B(0,2), C(1,1)$ to a variable line be zero. Then, all such lines(A) are concurrent(B) pass through the fixed point $(1,1)$(C) touch some fixed circle(D) pass through the centroid of $riangle A B C$
Let the algebraic sum of the perpendicular distances from the points $A(2,0), B(0,2), C(1,1)$ to a variable line be zero. Then, all such lines (A) are concurrent (B) pass through the fixed point $(1,1)$ (C) touch some fixed circle (D) pass through the centroid of $ riangle A B C$...
5 answers
The equation of the line passing through the point ( 2 , 3) and making intercept of length 2 units between the lines $y+2 x=3$ and $y+2 x=5$, is(A) $x=2$(B) $3 x+4 y=18$(C) $4 x+3 y=18$(D) none of these
The equation of the line passing through the point ( 2 , 3) and making intercept of length 2 units between the lines $y+2 x=3$ and $y+2 x=5$, is (A) $x=2$ (B) $3 x+4 y=18$ (C) $4 x+3 y=18$ (D) none of these...
5 answers
Two sides of a rhombus $A B C D$ are parallel to the lines $y=x+2$ and $y=7 x+3$. If the diagonals of the rhombus intersect at the point $(1,2)$ and the vertex $A$ is on the $y$-axis, then the possible coordinates of $A$ are(A) $(0,0)$(B) $left(0, frac{5}{2}ight)$(C) $left(0,-frac{5}{2}ight)$(D) none of these
Two sides of a rhombus $A B C D$ are parallel to the lines $y=x+2$ and $y=7 x+3$. If the diagonals of the rhombus intersect at the point $(1,2)$ and the vertex $A$ is on the $y$-axis, then the possible coordinates of $A$ are (A) $(0,0)$ (B) $left(0, frac{5}{2} ight)$ (C) $left(0,-frac{5}{2} ight)$ (...

Similar Solved Questions

5 answers
7. Two cards are selected at random without replacement from a well-shuflled standard 52-card deck:A Find the probability that one card is red and one card is black 26 Answer: 51 B. Find the probability that at least one of the cards is red_ 77 Answer: 102 C. Find the probability that one card is & red face card and the other card is a black face card .Answer: 221
7. Two cards are selected at random without replacement from a well-shuflled standard 52-card deck: A Find the probability that one card is red and one card is black 26 Answer: 51 B. Find the probability that at least one of the cards is red_ 77 Answer: 102 C. Find the probability that one card is &...
5 answers
Aselino PepeTHIS IS FORLaTech Stewart8e 5.1: Problem 1PreviousProbiem List Nextpoini} The valuetheiminDelcquathe area below Ine graphTunction f(-) enIniend LA,B2SVWna: f(r)?Wnat is A?(LelWhat i$ B7(Hint: O3 nol evaluate Inc Iimit )Note You can eam Dit Credton this problemPonieMme nnGhmiFea
aselino Pep e THIS IS FOR LaTech Stewart8e 5.1: Problem 1 Previous Probiem List Next poini} The value theiminDel cqua the area below Ine graph Tunction f(-) en Iniend LA,B 2SV Wna: f(r)? Wnat is A? (Lel What i$ B7 (Hint: O3 nol evaluate Inc Iimit ) Note You can eam Dit Credton this problem Ponie Mme...
5 answers
Exercise III: Volume of a cone Consider a cone with radius R and height h_13 Use cylindrical coordinates to find its volume. Draw figure first! 2 _ Use spherical coordinates to find its volume Draw picture first! You can usc the fact that; for all x € R,cos(tan x)32 +1Bonus if you prove this formulal
Exercise III: Volume of a cone Consider a cone with radius R and height h_ 13 Use cylindrical coordinates to find its volume. Draw figure first! 2 _ Use spherical coordinates to find its volume Draw picture first! You can usc the fact that; for all x € R, cos(tan x) 32 +1 Bonus if you prove ...
5 answers
"1 Show 3 tthe self inductance 2 unit length of straightl infinite IGhin 1 1
"1 Show 3 tthe self inductance 2 unit length of straightl infinite IGhin 1 1...
5 answers
SI Question: ptFind Seleckne the The 3 the real (Simplity cooedan 1) = solution 2 solutions choice 8 not sel Is 2 below 2 0 and of the comma jf necessany following equation. 1 ans the Use 3 Bf Doxio comnie @ method 1 1 1 12 of 20 (0 complete) Ver Q
SI Question: pt Find Seleckne the The 3 the real (Simplity cooedan 1) = solution 2 solutions choice 8 not sel Is 2 below 2 0 and of the comma jf necessany following equation. 1 ans the Use 3 Bf Doxio comnie @ method 1 1 1 1 2 of 20 (0 complete) Ver Q...
5 answers
T7HW Question 10 Homework UnansweredGiven the following first ionization energies for particular element on the periodic table, identify the element:800 kJ/mol 2427 klmol 3659 k/mol 25025 kJ/mol 32826 kl/molUnanswcredSubmit
T7HW Question 10 Homework Unanswered Given the following first ionization energies for particular element on the periodic table, identify the element: 800 kJ/mol 2427 klmol 3659 k/mol 25025 kJ/mol 32826 kl/mol Unanswcred Submit...
1 answers
Graph each solution set. Then write three ordered pairs that are solutions to the inequality. $$ 3 x+7 y \leq 14 $$
Graph each solution set. Then write three ordered pairs that are solutions to the inequality. $$ 3 x+7 y \leq 14 $$...
5 answers
Solve the system of equations using matrices (row operations).x+y-Z+w= - 5 3x - Y + 32 - Zw=72x + 2y+2-W=16 ~X-2y - 32 + 3w = 220 A. x= -2,Y=3,2=4,W=-2, (-2,3,4,- 2) 0 B. X= 2'y = - J,2=-dw-2 (2.-3-4-3) Oc x=2,y= -3,2=-4,w=-2, (2,- 3,-4,- 2) 0 D. x=-2,y= - 3,2=5, w=z (-2,-3, 5 , 2)
Solve the system of equations using matrices (row operations). x+y-Z+w= - 5 3x - Y + 32 - Zw=7 2x + 2y+2-W=16 ~X-2y - 32 + 3w = 22 0 A. x= -2,Y=3,2=4,W=-2, (-2,3,4,- 2) 0 B. X= 2'y = - J,2=-dw-2 (2.-3-4-3) Oc x=2,y= -3,2=-4,w=-2, (2,- 3,-4,- 2) 0 D. x=-2,y= - 3,2=5, w=z (-2,-3, 5 , 2)...
5 answers
Find the points at which the tangent line to the graph of function flx) = 2x' 24x+6 has slope equal to 0 [2.5 Marks] 6) Find the first derivative of (he function y = 2tan[cos(Bx)] at the point x = " [2.5 Marks] c) Find the second derivative of the Farametric equation X = 6 cSC- andy = col ( [2.5 Marks]Estion
Find the points at which the tangent line to the graph of function flx) = 2x' 24x+6 has slope equal to 0 [2.5 Marks] 6) Find the first derivative of (he function y = 2tan[cos(Bx)] at the point x = " [2.5 Marks] c) Find the second derivative of the Farametric equation X = 6 cSC- andy = col ...
5 answers
2 ft 25 Ib / ft2 ft2 ft200 Ib2 ft2 ft
2 ft 25 Ib / ft 2 ft 2 ft 200 Ib 2 ft 2 ft...
5 answers
The sequences below are part of a gene that runs from right to left 5' TATAGCTTAAGAGACTACCTTTTAGCTCGTA_3' 3' _ ATATCGAATTCTCTGATGGAAAATCGAGCAT_5'The top strand is known as the:PromoterCoding strandTemplate strandNon-template strand
The sequences below are part of a gene that runs from right to left 5' TATAGCTTAAGAGACTACCTTTTAGCTCGTA_3' 3' _ ATATCGAATTCTCTGATGGAAAATCGAGCAT_5' The top strand is known as the: Promoter Coding strand Template strand Non-template strand...
5 answers
Axgolfer hits a tee shot straight golf hole: on a 285 m long angle) 148 The ball is hooked (hit at an to the lelt from The ball lands 183 m the tee How far is the ball from the hole?
Axgolfer hits a tee shot straight golf hole: on a 285 m long angle) 148 The ball is hooked (hit at an to the lelt from The ball lands 183 m the tee How far is the ball from the hole?...
5 answers
Giving test t0 group of students, the table below summarizes the grade earned by gender:TotalMale Female Total"rone student is chosen at random, find the probability that the student was not @ female and did not = grade € . Round your answer to four decimal places. Garn Submit Question
Giving test t0 group of students, the table below summarizes the grade earned by gender: Total Male Female Total "rone student is chosen at random, find the probability that the student was not @ female and did not = grade € . Round your answer to four decimal places. Garn Submit Questio...
5 answers
Consider the experiment of picking three cards at random from astandard deck of 52 cards. Let Ai be the the event that the i-thcard is red (for 1 ≤ i ≤ 3). (a) What is the probability that allthree cards are red? (b) What is P(A1)? What is P(A2)? What isP(A3)? (c) Are A1 and A2 independent? (Explain your answer.)
Consider the experiment of picking three cards at random from a standard deck of 52 cards. Let Ai be the the event that the i-th card is red (for 1 ≤ i ≤ 3). (a) What is the probability that all three cards are red? (b) What is P(A1)? What is P(A2)? What is P(A3)? (c) Are A1 and A2 indep...
3 answers
Brady’s Bentleys is a worldwide dealer of luxury vehicles. Bradyhires you as an intern to help him make better decisions on howmany Bentleys he might sell next month. He provides you with thedata on the prior six months of unit sales.Month Unit Sales1 1002 2003 3004 4005 5006 6007
Brady’s Bentleys is a worldwide dealer of luxury vehicles. Brady hires you as an intern to help him make better decisions on how many Bentleys he might sell next month. He provides you with the data on the prior six months of unit sales. Month Unit Sales 1 ...
5 answers
Lalluuoclinoc a-rrnt daia <ntWotntetTuiek 0l p deoi alone]
lalluuo clinoc a-rrnt daia <nt Wotnt et T uiek 0l p deoi a lone]...
5 answers
Evaluate the following integrals (24 points) (a) J7 dx (b) J Vz2 + 25 dx (c) f arcsin(3) dx d J 2x arctan(x) dx (e) 2+1012+31+36 dx (1-1)(22+4)2 522 2t2 , V1 4t3 dt
Evaluate the following integrals (24 points) (a) J7 dx (b) J Vz2 + 25 dx (c) f arcsin(3) dx d J 2x arctan(x) dx (e) 2+1012+31+36 dx (1-1)(22+4)2 522 2t2 , V1 4t3 dt...

-- 0.078628--