5

ATCAAGAAACAAACTGCACTTGTTGAGCTCGTGAAACACAAGCCCAAGGCAACAAAAGAG CAAC TGAAAGCT 'GTTATGGATGATTTCGCAGCTZTTGTAGAGAAGTGCTGCAAGGCTGAC GATAAGGAGACCTGCTTTGCCGAGGAGGGTAAAA...

Question

ATCAAGAAACAAACTGCACTTGTTGAGCTCGTGAAACACAAGCCCAAGGCAACAAAAGAG CAAC TGAAAGCT 'GTTATGGATGATTTCGCAGCTZTTGTAGAGAAGTGCTGCAAGGCTGAC GATAAGGAGACCTGCTTTGCCGAGGAGGGTAAAAAACTTGTTGCTGCAAGTCAAGCTGCC TTAGGCTTATAACATCACATTTAAAAGCATCTCAGCCTACCATGAGHATAAGAGAAAGAA AATGAAGATC4ALAGCTTATTCATCTGTITTTCTTTZTCGTTGGTGTAAAGCCAACACCC TGTCTAAAAAACATAAATTTCTTTAATCATTTTGCCTCTTTTCTCTGTGCTTCAATTAAT AAAAAATGGAAAGAATCTAATAGACTGGTACAGCACTGTTATTTTTCAAAGATGTGTTGC TATCCTGAAAAZTCTGTAGGTTCTGTGGAAGTTCCAGTGTTCTCTCTTATTCCACTTCGG TAGA

ATCAAGAAACAAACTGCACTTGTTGAGCTCGTGAAACACAAGCCCAAGGCAACAAAAGAG CAAC TGAAAGCT 'GTTATGGATGATTTCGCAGCTZTTGTAGAGAAGTGCTGCAAGGCTGAC GATAAGGAGACCTGCTTTGCCGAGGAGGGTAAAAAACTTGTTGCTGCAAGTCAAGCTGCC TTAGGCTTATAACATCACATTTAAAAGCATCTCAGCCTACCATGAGHATAAGAGAAAGAA AATGAAGATC4ALAGCTTATTCATCTGTITTTCTTTZTCGTTGGTGTAAAGCCAACACCC TGTCTAAAAAACATAAATTTCTTTAATCATTTTGCCTCTTTTCTCTGTGCTTCAATTAAT AAAAAATGGAAAGAATCTAATAGACTGGTACAGCACTGTTATTTTTCAAAGATGTGTTGC TATCCTGAAAAZTCTGTAGGTTCTGTGGAAGTTCCAGTGTTCTCTCTTATTCCACTTCGG TAGAGGETTTCTAGTTTCTTGTGGGCTAATTAAATAAATCATTAATACTCTTCTAAAAAA AZAAAAAALAAAAAAGCCGAATTCTGCAGATAZCCATCACACTGGCGGCCGCTCGAGCAT GCATCTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTT TTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCCTCAGAGATCGATCGATCGATTG TTGCATGAGAAAACGCCAGTAAGTGACAGACTCACCAAATGCTGCACAGAATCCTTGGTG AACACCCGACCATGCTTTTCAGCTCTGGAAGTCCATGAAACATACGTTCCCAAAGAGTTT AATGCTGAAACATTCACCTTCCATGCAGATATAPGCACACTTTCTGAGAAGGAGAGACAA ATCAAGAAACAAACTGCACTTGTTGCAGCTCGTGAAACACAAGCCCAAGGCAACAAAAGAG CZACTGAAAGCTGTTATGGH TGATTTCGCAGCTTZTGTAGAGAAGTGCTGCAAGGCTGAC GATAA GGAGACCTGCTTTGCCGAGGAGGGTAAAAAACTIGTTGCTGCAAGTCAAGCTGCC ITAGGCTTATAACATCACATTTAAAAGCATCTCACCCTACCATGAGAATAAGAGAAAGAA la) Using the sequence above, design your forward and reverse primers; following the guidelines Primer length 15-30 nucleotides Tm should range between 55 65C Tm of primer pair should be within SC of each other GC content of primer = 40 60% Try to avoid a row of 4 or more ofthe same bases s0 for eg: GGGGG or ATATATATAT 3' end of primer should end with G or € 1b) Provide the sequences in a 5'-3' direction as if you were going to order them: Include the start and stop bases and number for both primers and length of primer. Forward primer in 5' 3' direction. Reverse primer in 5' 3' direction Ic) Estimate the melting temperature of the primers You designed Tm =4(number of GC) + 2(number of AT) 1d) Describe the thermal cycling protocol that you would predict to work Provide the denaturation temperature, the 'annealing temperature, and the extension temperature:



Answers

The common thermal polymerase chain reaction (PCR) process requires the cycling of reagents through three distinct temperatures for denaturation $\left(90-94^{\circ} \mathrm{C}\right),$ annealing $\left(50-55^{\circ} \mathrm{C}\right),$ and extension $\left(72^{\circ} \mathrm{C}\right) .$ In continuous-flow $\mathrm{PCR}$ reactors, the temperatures of the three thermal zones are maintained as fixed while the reagents are cycled continuously through these zones. These temperature variations induce significant variations in the fluid density, which under appropriate conditions can be used to generate fluid motion. The figure depicts a thermosiphon-based PCR device (Chen et al., 2004 , Analytical Chemistry, $76,3707-3715$ ). The closed loop is filled with PCR reagents. The plan of the loop is inclined at an angle $\alpha$ with respect to the vertical. The loop is surrounded by three heaters and coolers that maintain different temperatures. (a) Explain why the fluid automatically circulates in the closed loop along the counterclockwise direction. (b) What is the effect of the angle $\alpha$ on the fluid velocity?

Oceaneer asks. Why would the primaries would not work? Well, so for eight here we know that the primers have very warning and side of seen contents and for be here is as the forward farmer. So forward primer will have a significant secondary structure, um, within itself. And lastly for see here we basically know that the both forward on reverse reactions here will bind to each other.

Explanation for the above US question. Primer primers can be used to test lip prairies containing long genomic gloans to distinguish content. Contact ends but are close to each other in cases where the yeah, con pigs I'm flanking. Yeah, the game are close. What, enough? The primer skin be used in B C are to specifically in amplify the intervening DNA that so Brits the counting countings afterward, These can be ground what cloned and C advanced.

Okay, so for this particular problem, just to go over what they're asking of us, you're trying Teoh PCR a piece of DNA. And we've got two primers, this one on the top that mark appear with a green dot and this one in the bottom that I murdered down here with a blue dot um, And when we run PCR, we're expecting, you know, to see these nice bands separated from each other. Instead, we see a smear that's about 25 to 30 base pairs. So why is that? So when you look at these to primers together, there's a reason I set this up this way, and it's because the primers actually overlap at their ends. So these lines that I'm drawing or not just for fun, each one of these has a complimentary base pair on the other side that they can bond with. So what's probably happening is that the primers are a kneeling to one another instead of the sequence that you're trying to get them Teoh to Aneel with. So by doing this, they're not binding to the DNA sequence that you're trying to get them divine to their Vinings one another and if you look even closer, this from this to the end of this, that's exactly 25 base pairs. So by counting issue number one of these which you can dio, um you will see that it pretty much matches with the results that you're getting this this 25 30 base pair smear on your electrophoresis shall. Okay, so issue here again is that the primers have overlap where they can and Neil to one another because of the complementary base pairs.

Logo on. This is Ricky. And today we're walking through Problem 61 from chapter 14. This is a question on saying your sequence. So, first, sweetie nature DNA, uh, a sample to four different test tubes. Next, we add DNA pulling Marie's DEA and teepees and a small number off a different TD and T P thio each two. After that, um, we allow them Thio, Aneel and the Long Gage. Then you can run him through Joe and a laser sequencing. Um, Thio get the fluorescent, uh, to see where the flesh prints of the DD into pizza located to this alliance with the answer. True. Say what's really was helpful Soon.


Similar Solved Questions

5 answers
1 1 HH 1 HL 1 L lulatla Hanmondl 1 solubuly-cuuc Hatetal J 1 (K) 1 8 1 1 1 L 1 olIns 1 utarce8 ' iont Lad
1 1 HH 1 HL 1 L lulatla Hanmondl 1 solubuly-cuuc Hatetal J 1 (K) 1 8 1 1 1 L 1 olIns 1 utarce 8 ' iont Lad...
5 answers
Consider the following quantificationally true sentence of PL: (Vx)Px V ~ (Vx)Px. Why is it impossible to check all of the interpretations of PL to determine that the sentence is quantificationally true?
Consider the following quantificationally true sentence of PL: (Vx)Px V ~ (Vx)Px. Why is it impossible to check all of the interpretations of PL to determine that the sentence is quantificationally true?...
3 answers
Challenge problem 7.2. LetA =Eigenvaluesand 2_ Show that A is similar to
Challenge problem 7.2. Let A = Eigenvalues and 2_ Show that A is similar to...
5 answers
1. Say whether the following subsets of R are open, closed, neither, or both Give reasons. [0, 1); p. % {I € R: sinz > 0}, UR-2[1/n,1).
1. Say whether the following subsets of R are open, closed, neither, or both Give reasons. [0, 1); p. % {I € R: sinz > 0}, UR-2[1/n,1)....
5 answers
Find the volume of the indicated region:the region bounded above by the sphere x2+y2 +22 81 and below by the cone 2= F.yz 2437(2 4) 2430(2 -46) 77(2 - ~i) 2n(2 - ~5)
Find the volume of the indicated region: the region bounded above by the sphere x2+y2 +22 81 and below by the cone 2= F.yz 2437(2 4) 2430(2 -46) 77(2 - ~i) 2n(2 - ~5)...
5 answers
Points sCalcET8 13.3.012My NotesAsk Your TeachFind; correct four dccmal places, the length the curvcIntersechomthe cylinder 25x225 and the planeNeed Help?nlen mua
points sCalcET8 13.3.012 My Notes Ask Your Teach Find; correct four dccmal places, the length the curvc Intersechom the cylinder 25x2 25 and the plane Need Help? nlen mua...
5 answers
A strain of E. coli is genetically engineered in which the lacZ with gene encoding fluorescent protein: A copy of the gene for red fluorescent protein is inserted and replaces lacZ in the chromosome which has the genotype |-O+Z+. The cell has plasmid with the I+O+Z+ where the lacZ gene is replaced with a green fluorescent protein: If you add lactose; what will you see?greenredno coloryellow
A strain of E. coli is genetically engineered in which the lacZ with gene encoding fluorescent protein: A copy of the gene for red fluorescent protein is inserted and replaces lacZ in the chromosome which has the genotype |-O+Z+. The cell has plasmid with the I+O+Z+ where the lacZ gene is replaced w...
1 answers
Before quantum mechanics was developed, Johannes Rydberg developed an equation that predicted the wavelengths ( $(\lambda)$ in the atomic spectrum of hydrogen: $$ 1 / \lambda=R\left(1 / m^{2}-1 / n^{2}\right) $$ In this equation, $R$ is a constant and $m$ and $n$ are integers. Use the quantum-mechanical model for the hydrogen atom to derive the Rydberg equation.
Before quantum mechanics was developed, Johannes Rydberg developed an equation that predicted the wavelengths ( $(\lambda)$ in the atomic spectrum of hydrogen: $$ 1 / \lambda=R\left(1 / m^{2}-1 / n^{2}\right) $$ In this equation, $R$ is a constant and $m$ and $n$ are integers. Use the quantum-mechan...
5 answers
Dvuniont certaintImta 1 1 H of the particle during this 8.8 $ interval? meIn thc positivc * direction, and 8.8 $ later Its spced Isoddo3u1ulsnuz?
dvuniont certaintImta 1 1 H of the particle during this 8.8 $ interval? meIn thc positivc * direction, and 8.8 $ later Its spced Isoddo3u1ulsnuz?...
1 answers
(a) Find a nonzero vector orthogonal to the plane through the points $P, Q,$ and $R,$ and $(b)$ find the area of triangle $P Q R .$ $$ P(2,-3,4), \quad Q(-1,-2,2), \quad R(3,1,-3) $$
(a) Find a nonzero vector orthogonal to the plane through the points $P, Q,$ and $R,$ and $(b)$ find the area of triangle $P Q R .$ $$ P(2,-3,4), \quad Q(-1,-2,2), \quad R(3,1,-3) $$...
5 answers
Write each polynomial in standard form. Then classify it by degree and by number of terms.$$6 x^{3}-x^{3}$$
Write each polynomial in standard form. Then classify it by degree and by number of terms. $$ 6 x^{3}-x^{3} $$...
4 answers
Through vacuum in the direction Is polarized parallel to the y-axis. At the origin; A 1.0 MHz radio wave traveling the electric field at t = 0 seconds is € (10O0 VIm) ; 1.26*106Tm/A the permittivity constant co is = 8.85*10-12 C?/(N m?) and the The permeability constant /0 is speed of light is 3 3.00x108 m/s. Sclcct / magnitude ' and points in the The magnetic field at this E location has _[Sclect |direction;
through vacuum in the direction Is polarized parallel to the y-axis. At the origin; A 1.0 MHz radio wave traveling the electric field at t = 0 seconds is € (10O0 VIm) ; 1.26*106Tm/A the permittivity constant co is = 8.85*10-12 C?/(N m?) and the The permeability constant /0 is speed of light is...
5 answers
The a558t5 phons ai dollars) ol the lour #cathicd Gconi morulion otroUr valulspuKlu cuntry arc 43, 35 28Acurt Hntolc?Sucn =randomk scecnomcpucemtn ouocnutniolnc Ltamnpe Mean Inadmcten Porbz implc : ano Iinino smr have becn combi€0mcenFnchaanele conaeniorcpreacnbnnnmplm duat tDatnrIntena tabe LauaProbtbllitProbtbilaanselIne eoit Iicdr ardthedc Ched Entt_
The a558t5 phons ai dollars) ol the lour #cathicd Gconi morulion otroUr valuls puKlu cuntry arc 43, 35 28 Acurt Hntolc? Sucn = randomk scecno mcpucemtn ou ocnutniolnc Ltamnpe Mean Ina dmcten Porbz implc : ano Iinino smr have becn combi€0 mcen Fnchaanele conaenio rcpreacnbnn nmplm duat t Datnr ...
5 answers
QuestionMukProve that ux;y)=bog(r? -y is harmonic function and find harmonic conjugate
Question Muk Prove that ux;y)=bog(r? -y is harmonic function and find harmonic conjugate...
5 answers
7 (15) Find the work done by the force F = xi + yj by pushing a particle along the semi-circle from (1,0) to (_1,0), then along the_X-axis back to the starting point (1,0).
7 (15) Find the work done by the force F = xi + yj by pushing a particle along the semi-circle from (1,0) to (_1,0), then along the_X-axis back to the starting point (1,0)....

-- 0.023200--