5

8 3 2 3/6 H 3 3 4/10 3/6 Hh 3 are enjoys math: boys boys 'girl? H whrad 5 2 gires 0 math? probability class probability class. W thova 38 and student chislerf ...

Question

8 3 2 3/6 H 3 3 4/10 3/6 Hh 3 are enjoys math: boys boys 'girl? H whrad 5 2 gires 0 math? probability class probability class. W thova 38 and student chislerf girls from - from chosen 1 nthhis tronc slaass clthis enjoy chisy

8 3 2 3/6 H 3 3 4/10 3/6 Hh 3 are enjoys math: boys boys 'girl? H whrad 5 2 gires 0 math? probability class probability class. W thova 38 and student chislerf girls from - from chosen 1 nthhis tronc slaass clthis enjoy chisy



Answers

PROBABILITY There are 8 girls and 8 boys on the Faculty Advisory Board. Three are juniors. Find the probability of selecting a boy or a girl from the committee who is not a junion

All right. So in this problem, we have five boys, three girls, three choices that we have to make. Boys and three girls total hands were asked to find the probability selecting two boys or two girls. When you have three choices self, the way we're gonna do this is we're gonna find the probability of selecting two boys. Add that to the probability of selecting two girls. So in this case, the probability is going to be equal to so first we had to select two boys out of five voice. So this thing that I'm writing down here is essentially all the ways that you can choose to boys from the total amount of five boys that in addition to this, if we choose to boys, we also have to select one girl combination of three girls would choose one. Now on the bottom, we're gonna have all the ways to select three different people. This is gonna be a combination of eight comma three. So in this example, we're finding the probability are in the first part we're finding the probability of choosing to boil all the ways to choose two boys on five total boys and multiplying it by the probability are how many ways there are to choose one girl out of three total girls on dividing it by the total amount of ways to choose three people from eight combinations here and the order does not matter. So we're using common. Now we need to add this to the probability choosing to girls. So if you choose to girls, we've gotta choose one boy who would choose this all the ways that we can choose one boy out of five total. Multiply that with all the way you girls on five total on Divide that by all the ways, choose three people out of it. So in this case, we have times three over sex plus five times three violet by 56. And this is just simply from plugging each one these combinations into a calculator, figuring out which one is This is gonna be 45

So in this example were given a total people five boys, three girls. It's like three of them were asked probability of selecting at least two girls, which we know we could decipher. This The only way is disliked at least two girls is to select two or three girls. In this case, since the event, close it. I'm gonna find the probability of selected two girls. Add it to the probability of So in order to select two girls, you must like you girls out of total three multiplied with amount ways. One boy, five total. In this, it's all gonna be over a number of ways. Choose three people total. Now, if we want to slight three girls, we have two sluts, all three of the woman. Then we also have to select zero of the boys. So after we plug this, enjoy calculator three times five over sex plus one one over 56. D'oh 16 over 56 which to over seven

You can do that, too, with at least two females, Children. So by looking at the sample set of eight, We know that the number of the event is going to be four. Therefore, the probability is going before over a two, which is also equal to one half.

So in this example, people, three choices five boys three girls on were as to find the probability of selecting at least one. So if we have to select at least one boy, then we can select either one or two or three. So we know in this case, um so in this case, were given a couple of choice. When we're making our choices, we have a conflict. Zero boys, one boys, two boys, three boys. So in this case, we know that's the only events not included in this is the probability of choosing zero boys. So in order finds ah, little shortcut that we can use to find the probability choosing one for two three boys to be equal to one minus probability, choosing zero. Since we know the probability of choosing one or two or three or zero boys occurs with the probability of one if we just take. So there's only four possible things that could happen here. You have to choose 123 or zero Boyd's. We know that's probability of one or two or three makes up some probability fraction here and then the only other part of this left is the probability of zero boys. So we know all these probabilities will add up to one. We take the probability selecting zero boys and take one minus. That's we'll get the probability of one or two or three since all these possibilities our exhaust. So instead of find the probability of selecting one or two or three boys and adding them all together, we could just find the probability finding zero boys are choosing zero boys tracked. So, in this case, probability of selecting near boys. So we must select all three girls and we must also select 05 boys all over the total number of ways to select three things. So vehicles one times one six, which is just gonna be equal to 1/56. So now we must take. Now we must take one minus one of six gonna be equal five over 50. So if we know that the probability of selecting zero boys is one out of 56 then then we also know the probability of selecting one or two or three, which is the only other things that are left possible. Five over


Similar Solved Questions

5 answers
15 Complete - the following Cannizzaro KOH reaction16 Nylon 26 of polyurethane. micelle Lrdrophobic B) whereas polyester. [ the [ exteri C) pol
15 Complete - the following Cannizzaro KOH reaction 16 Nylon 26 of polyurethane. micelle Lrdrophobic B) whereas polyester. [ the [ exteri C) pol...
5 answers
Determine whether these statements are true or false_0 e {V} {V} € {W} {V} € {V, {V}} {{V}} € {{V}, {V}}b) V e {V, {V}} d) {V} e {{V}} f) {{V}} € {V, {V}}
Determine whether these statements are true or false_ 0 e {V} {V} € {W} {V} € {V, {V}} {{V}} € {{V}, {V}} b) V e {V, {V}} d) {V} e {{V}} f) {{V}} € {V, {V}}...
5 answers
Go to Pg: 8344 AA Differentiation of Vector-Valued Functions In Exercises 3,4,5,6,7, 8, 9,and 10 find <' (),r (to) and 0' (to) for the given value of to. Then sketch the curve represented by the vector-valued function and sketch the vectors = (to) andr' (to):3.1 (t) = (1-2)1+t to = 3Anstr -41()2(+t)i+t} to =15.r(t) cos ti sin t, to =Antanr 2' (t)sin ti + cos tj ()=j6.0 (t)sia ( F c05 (,
Go to Pg: 834 4 AA Differentiation of Vector-Valued Functions In Exercises 3,4,5,6,7, 8, 9,and 10 find <' (),r (to) and 0' (to) for the given value of to. Then sketch the curve represented by the vector-valued function and sketch the vectors = (to) andr' (to): 3.1 (t) = (1-2)1+t t...
5 answers
(juo 3[P11?) Ie[oduoN 1O JB[Od "S?jBUV pUogJu0 3p3113) IB[OdUON IO Ie[Od 'sojuV puogSuIAteJd (-€JuLMBJc (-€:nauoan) JB[nOJ[OWKnJuoJp) JeInJJ[oW:aInionJiS S1M?T Junoj uOn?p? Ju?[BA [BIOLamnonuls SlM3] Junoj uOIa[3 Jjua[eA [B1OLJWPN'JUBNsTJs :B[QUJO [ #e[noz[oW"BInuuo IE[nJ?[OW (S
(juo 3[P11?) Ie[oduoN 1O JB[Od "S?jBUV pUog Ju0 3p3113) IB[OdUON IO Ie[Od 'sojuV puog SuIAteJd (-€ JuLMBJc (-€ :nauoan) JB[nOJ[OW KnJuoJp) JeInJJ[oW :aInionJiS S1M?T Junoj uOn?p? Ju?[BA [BIOL amnonuls SlM3] Junoj uOIa[3 Jjua[eA [B1OL JWPN 'JUBN sTJs :B[QUJO [ #e[noz[oW ...
5 answers
Between motor neurons21. Which nerve has been displayed in the picturesensory nervemotor nerveinter-neuronrelay neuron22. The condition Inlwhlchthe calclumiof bones are lostJel eelerars[
Between motor neurons 21. Which nerve has been displayed in the picture sensory nerve motor nerve inter-neuron relay neuron 22. The condition Inlwhlchthe calclumiof bones are lost Jel eelerars[...
5 answers
Omework: CHAP IER 2 REVIEW (Counts aore: 0 of 1 pt1 of 36 (0 complete)structor-created question"he helght (feet) of a bal launched in Ihe air seconds altor It Is launchod given Dy:M(u) = 1612 209t :The velocity of the ball when at a height of 120 feet IsfUsec.necessany; round t0 tWo decimal places. Mf there more Ihan ona correct answer; soparate them vath
omework: CHAP IER 2 REVIEW (Counts a ore: 0 of 1 pt 1 of 36 (0 complete) structor-created question "he helght (feet) of a bal launched in Ihe air seconds altor It Is launchod given Dy: M(u) = 1612 209t : The velocity of the ball when at a height of 120 feet Is fUsec. necessany; round t0 tWo dec...
5 answers
UP-element35-10ATCGATTATTATATCTGAAATCTAGACTATCAAAAATGGATCCCCTATCCAGATTATA TAGCTAATAATATAGACTTTAGATCTGATAGTTTTTACCTAGGGGATAGGTCTAATAT
UP-element 35 -10 ATCGATTATTATATCTGAAATCTAGACTATCAAAAATGGATCCCCTATCCAGATTATA TAGCTAATAATATAGACTTTAGATCTGATAGTTTTTACCTAGGGGATAGGTCTAATAT...
5 answers
21) Is a set has 32 number of subsets, find its number of elements:A) 3B) 5C) 4D)22) Given set A =x e R:x2 =x} and set B= {x € R: - 2 < < 2Which one of the following is & TRUE statement? A) AS B B) B E A C) A # B D) A and B
21) Is a set has 32 number of subsets, find its number of elements: A) 3 B) 5 C) 4 D) 22) Given set A =x e R:x2 =x} and set B= {x € R: - 2 < < 2 Which one of the following is & TRUE statement? A) AS B B) B E A C) A # B D) A and B...
1 answers
Add the ordinates of the individual functions to graph each summed function on the indicated interval. $$y=8 \cos x-6 \cos \left(\frac{1}{2} x\right),-2 \pi \leq x \leq 2 \pi$$
Add the ordinates of the individual functions to graph each summed function on the indicated interval. $$y=8 \cos x-6 \cos \left(\frac{1}{2} x\right),-2 \pi \leq x \leq 2 \pi$$...
1 answers
Use Figure 8 in this section to determine which quantity is larger. Then use a calculator to check the answer. For the calculator values, round to two decimal places. $$\sin 190^{\circ} \text { or } \cos 190^{\circ}$$
Use Figure 8 in this section to determine which quantity is larger. Then use a calculator to check the answer. For the calculator values, round to two decimal places. $$\sin 190^{\circ} \text { or } \cos 190^{\circ}$$...
5 answers
Find the area of te region under tha graph cf the functicn fon the' Interval [1, 5]:square unitsNeed Help?72aLadah[-/1 Points]DETAILSTANAPCALCBR1O 6.4.012Find the area of the region under the graph of the function on the interval [1, 5].Jx3square unitsNeed Help?Rend Il[-/1 Points]DETAILSTANAPCALCBR1O 6.4.015.Find the area (In square unlts) of the region under the graph of the function on the Interval [0, 31. Jetsquare units
Find the area of te region under tha graph cf the functicn fon the' Interval [1, 5]: square units Need Help? 72a Ladah [-/1 Points] DETAILS TANAPCALCBR1O 6.4.012 Find the area of the region under the graph of the function on the interval [1, 5]. Jx3 square units Need Help? Rend Il [-/1 Points] ...
5 answers
(5 , 2 - zu4u qu
(5 , 2 - zu 4u qu...
5 answers
49. Label the peaks of benzaldehyde in the following 1H NMR spectrum:10PPM1072 wordsLEnglish (United States)Focus
49. Label the peaks of benzaldehyde in the following 1H NMR spectrum: 10 PPM 1072 words L English (United States) Focus...
5 answers
ADPreview File Edit View Go Tools Window HelpScreen Shat 2020-06-18 at 6.30.47 AMThe indicated function Y1(x) is a solution of the given differential equation_ Use reduction of order or formula (5) in Secpon 4.2, e-fP(x) ax Yz = Yi(x) (5) v2 (x)as instructed, to find a second solution Yz(x) . 3x/5 25y" 30y' + 9 = 0; Y1Y2Talk to TutorNeed Help?Watch ItRead Itrth 0=(644)*0= (I-4*0 =SubmitAnswer
AD Preview File Edit View Go Tools Window Help Screen Shat 2020-06-18 at 6.30.47 AM The indicated function Y1(x) is a solution of the given differential equation_ Use reduction of order or formula (5) in Secpon 4.2, e-fP(x) ax Yz = Yi(x) (5) v2 (x) as instructed, to find a second solution Yz(x) . 3x...

-- 0.019805--