5

GTGCATCTGACTCCTGACCACAACANATranseriptionRNAIIlonFratein...

Question

GTGCATCTGACTCCTGACCACAACANATranseriptionRNAIIlonFratein

GTGCATCTGACTCCTGACCACAAC ANA Transeription RNA IIlon Fratein



Answers

What is antisense RNA?

Question about R and A. And so are they, of course, is ribonucleic acid. And as the chapter outlines, there are three particularly important card kinds of our day. There's M R and A, which is messenger are in a there's t iron A or transfer or in a And then there's bribe Osama Laurene. Witches are are in a and are in a is the product of transcription. So what you have is a DNA molecule. Remember that DNA molecules are double stranded, so they consist of Siri's of basis like that. And what happens is that that molecule opens upper peels back to expose one strand of D N A. That's my DNA molecule, and then you are in a molecule is produced that is transcribed by having complementary bases pair here like this. So that's how are in a molecules and it that is true for M. R and a tiara and are so the answer here is de all of them results from transcribing a single strand of DNA

What do you get when a bacterial RNA primaries transcribes a protein coding genes? Is it our Rene T RNA mRNA or S N R N A. So the fate of this piece of RNA is to be translated into a protein, so it has to be see an mRNA because that's what we translate into proteins.

Hi. To answer this question, let's talk a little bit about protein synthesis. In other words, how proteins are made from DNA. So the first thing that happens is the DNA. The code is red and made into messenger RNA. This is referred to as transcription, So transcription makes the messenger RNA. Thanks. Messenger RNA is a strength single strand that contains the code, um, three letters at a time. So perhaps we have you a c g g. Hey, t. We expect that up. There is no t in message on a I'm just kind of making something up here, so and then a C c and then moved out data. So this is my messenger RNA. The messenger RNA is made up of three letter codes Bonus code Unz and each coat on represents an amino acid. So this now needs to be translated. In other words, it needs to be made into a protein. We know proteins are long chains of amino acids. What happens during translation is that a transfer RNA molecule matches up with the code ons in the messenger RNA, and this occurs at a ripe zone. So transfer RNA, um, a lot of times you'll see it drawn out something that looks something like this, where at the one end, it contains an anti code on and the correct anti code on would pair up with a coat on. So, for example, if I'm looking at the code on here that has a C C, the one that would match up with that, the anti code on would be you G. The other end of this carries the specific amino acid that the code on would code for, and it will bring them, you know, acid in and link it to the other amino acids that have already been linked together through a peptide bond, and the protein would be formed that way. Then you would go to the next code on and another transfer RNA that has an anti code on that matches. The next code on would come in and bring in its amino acid. All right, with the point being looking back at the question here. If we're asking where we find antique Oden's, the correct answer is going to be letter C in transfer RNA. All right, so let her see is our correct answer. That's where we find the anti Codacons

Okay. So, out of these four options, which one codes for the creation of a Prodi? So option A is double stranded Arnie, which is, ah, useful for silencing of gene expression and is found in viruses. So that's not what we're looking for. See, rebuttable are in a also doesn't code for proteins. It's used in the creation of ribosomes, so that's not it. Tr in a transfer I run a is used to transfer Amin assets during the process of translation, so that's not it either. That leaves us with Amorin, a messenger. I run a, which is indeed a copy off the gene encoded in DNA that is used in Robison's to assume old to make Prodi. So this is the answer we're looking for.


Similar Solved Questions

5 answers
Suppose =, Y are independent random variables with X ~ Unif(o.2) and Y EXP(3). Let U = X and V = 2X - 3Y .Find the joint density of (U.V) Use YOur result from the part above to find the marginal density of V_
Suppose =, Y are independent random variables with X ~ Unif(o.2) and Y EXP(3). Let U = X and V = 2X - 3Y . Find the joint density of (U.V) Use YOur result from the part above to find the marginal density of V_...
5 answers
2 5.1.53QuesbarchaededH etduvaton 0 75Wra onmantulndchnla210mtdL?IRound Io NaFnirtcdFninafenntuibuc Iochols"aYc knels betxeen /50 and 162 nydl;IFulrenaedadrmam(nieflu Fanju 0l onolosoefnlemaal AcuctotramnlegerFLid"2 AbonWvu ureiaRetat 157. & udurs' ccluarnADTIeans TueaTeejud |answc DJi trencld Credparta thaningAAMacBaok Air5H
2 5.1.53 Quesbar chaeded H et duvaton 0 75 Wra onmant ulnd chnla 210mtdL? IRound Io Na Fni rtcd Fninafennt uibuc Io chols"aYc knels betxeen /50 and 162 nydl; IFulre naedad rmam (nieflu Fanju 0l onolosoefnle maal Acuctotra mnleger FLid" 2 Abon Wvu ureiaRetat 157. & udurs' ccluarn A...
5 answers
Evaluate sin( 3 + i) in the = + iy form
Evaluate sin( 3 + i) in the = + iy form...
5 answers
PROBABILITYProbabilities involving two independent eventsEvents 4 and B are independent: Suppose event A cccurs with probability 0.18 and evert B occurs with probability 0.10.Compute the probabillty that A does not occur or B does not occur (or both) Compute the probabillty that either A occurs without K occurring or K occurs without 4 occurring (If necessary, consult list_of_formulas. )
PROBABILITY Probabilities involving two independent events Events 4 and B are independent: Suppose event A cccurs with probability 0.18 and evert B occurs with probability 0.10. Compute the probabillty that A does not occur or B does not occur (or both) Compute the probabillty that either A occurs w...
5 answers
Find the radius of convergence of the following power series:a) $^{infty} sum_{n=1}left(x^{n} / night)$b) ${ }^{infty} Sigma_{mathrm{n}=1}left{(2 mathrm{n}) ! /(mathrm{n} !)^{2}ight} mathrm{x}^{mathrm{n}}$c) $^{infty} Sigma_{mathrm{n}=1}left{(3 mathrm{n}) ! /(mathrm{n} !)^{2}ight} mathrm{x}^{mathrm{n}}$
Find the radius of convergence of the following power series: a) $^{infty} sum_{n=1}left(x^{n} / n ight)$ b) ${ }^{infty} Sigma_{mathrm{n}=1}left{(2 mathrm{n}) ! /(mathrm{n} !)^{2} ight} mathrm{x}^{mathrm{n}}$ c) $^{infty} Sigma_{mathrm{n}=1}left{(3 mathrm{n}) ! /(mathrm{n} !)^{2} ight} mathrm{x}^{m...
5 answers
Which fall faster, large or small raindrops?
Which fall faster, large or small raindrops?...
5 answers
How many moles of oxygen are formed when 30.01 g of KNO: decomposes according to the following reaction? The molar mass of KNOz is 101.11 g/mol KNO:(s) 2 KzO(s) + 2 Nzlg) 5 Ozlg)Give the answer to 2 decimal places.
How many moles of oxygen are formed when 30.01 g of KNO: decomposes according to the following reaction? The molar mass of KNOz is 101.11 g/mol KNO:(s) 2 KzO(s) + 2 Nzlg) 5 Ozlg) Give the answer to 2 decimal places....
5 answers
A10-kg block is suspended by arope from the ceiling of an elevator as the elevator accelerates up ward at 2.Om/s2, The tension force of the rope On the block is:BON'T6ONHooNT20 NSON
A10-kg block is suspended by arope from the ceiling of an elevator as the elevator accelerates up ward at 2.Om/s2, The tension force of the rope On the block is: BON' T6ON HooN T20 N SON...
5 answers
Find the solution of the differential equation that satisfies the given initial condition. xy' +y =y2 Y(1) = -7X
Find the solution of the differential equation that satisfies the given initial condition. xy' +y =y2 Y(1) = -7 X...
5 answers
[-/1 Points]DETAILSZILLOIFFEQ9 1.1.037 .MY NOTESASk YOUR TEACHERPRACTICE ANOTHERconcejtttal /constant lurcuononkiYdetermene Tnetherairen dilererus equalion Posselyes coryani soluvons (Enterconstant Jolutons Deaweconscane scutiors enter Nonie )Need Help?
[-/1 Points] DETAILS ZILLOIFFEQ9 1.1.037 . MY NOTES ASk YOUR TEACHER PRACTICE ANOTHER concejtttal / constant lurcuon onkiY determene Tnether airen dilererus equalion Posselyes coryani soluvons (Enter constant Jolutons Deawe conscane scutiors enter Nonie ) Need Help?...
1 answers
Suppose the eigenvalues of A in R2x2 are Ai =land Az your answer:What are the eigenvalues of A + I? JustifyHint: If Ar = Ar what is (A + IJx?
Suppose the eigenvalues of A in R2x2 are Ai =land Az your answer: What are the eigenvalues of A + I? Justify Hint: If Ar = Ar what is (A + IJx?...
5 answers
What are the major GMO crops grown commercially? Name the topfive countries growing them. What are the major GMtraits?
What are the major GMO crops grown commercially? Name the top five countries growing them. What are the major GM traits?...
5 answers
Volume %f Brillouin Sone. Show thaut the volte o tle lirst Brillouin ne (2#)NVc, where Vc is the volume of eystal primitive cell Hint: Tle volume ol Brillouin zone is equal to the volume of' the primitive parullelepiped in Fourier space. Recall the vector identity (c Xa) xX ( xb) = (c a X bla
Volume %f Brillouin Sone. Show thaut the volte o tle lirst Brillouin ne (2#)NVc, where Vc is the volume of eystal primitive cell Hint: Tle volume ol Brillouin zone is equal to the volume of' the primitive parullelepiped in Fourier space. Recall the vector identity (c Xa) xX ( xb) = (c a X bla...
5 answers
Let Tlr) = Ax be linear Iransformation where4 Find the kemel and Range of T
Let Tlr) = Ax be linear Iransformation where 4 Find the kemel and Range of T...
5 answers
3 (2 pts) Let f(z,y,2) = xsin(3y + 22). Find the first derivatives of f Find all second partial derivatives and explain why the mixed derivatives fry, f"; and fly do not depend on the order of differentiation_
3 (2 pts) Let f(z,y,2) = xsin(3y + 22). Find the first derivatives of f Find all second partial derivatives and explain why the mixed derivatives fry, f"; and fly do not depend on the order of differentiation_...

-- 0.021294--