5

(a) Solve the Euler equation ry" 3rv' + 4y = 0. You should obtain only one solution. (b) We know that there should be two solutions_ Show that r2 lnI, I &...

Question

(a) Solve the Euler equation ry" 3rv' + 4y = 0. You should obtain only one solution. (b) We know that there should be two solutions_ Show that r2 lnI, I > 0, solution is also

(a) Solve the Euler equation ry" 3rv' + 4y = 0. You should obtain only one solution. (b) We know that there should be two solutions_ Show that r2 lnI, I > 0, solution is also



Answers

Find the general solution to the given Euler equation. Assume $x>0$ throughout. $$4 x^{2} y^{\prime \prime}+y=0$$

Okay, so here's the problem that's given to us. The first thing that you want to do is isolate the square root so that you can square both sides and get the are out of the square root. So what I'm going to do first is At our and subtract two from both sides. And once I do that I am left with screwed of R plus four equals ar minus two. Now I can square both sides and get that are on the left side of the equation out of the square root. When I do that I have are plus four equals R squared minus four. R plus four. And now what you can do is subtract are from both sides and subtract four from both sides. Once you subtract are from both sides, you'll have four equals R squared minus five R plus four. And then the fours will cancel out from both sides of the equation So that your life was zero equals r squared minus five. Are, what I would do here is like a reverse of the distributed property, which is that you would take our out of the equation are out of Part of the equation so that you have zero equals r times ar minus five. And by doing this you can then set up to equalities. Um because multiplying any Number Times zero gives 0, you can set up this equation so that R equals zero and ar minus five equals zero. Because if either one of those equations happens to equal zero then the other side will too. So from our equal zero and ar minus five equals zero, we get the solutions zero and five. So now we have to plug those back into the initial equation to see if they both still ring true. By plugging zero into the initial equation we would get square root of four minus zero plus two equals zero. Square root of four is obviously just two, and then zero is a non factor, so we have two plus two equals zero, which obviously is not true, Which means that zero is not actually a solution. Meanwhile, if we have our equals five, we can plug that back into the initial equation to have the square root of 5-plus 4 minus five plus two equals zero, and then five plus 4 to 9 in the square root of minus three. So three minus five plus two equals zero Is true because then you get zero equals zero. So here five is the only solution And R. equals zero is not an actual solution.

And we'll be able to find the two values of arses that very close to it is the power Rx is a solution of valuable less managed by this, managed to wage goes to zero so valuable this madness providers manage to constitute so we can write, did to weigh upon D x squared minus of levi upon dx Months of two by the cost of zero. So we can get this carmen is a D -2. Dubai close to zero. Speak and write do you monastery into deep Lisbon because of curiosity cost too. And the coastal minus one So solution can return is very costume into into the power do we express being two to the power one has run into X. So the value of RS two, the value of artists too and minus one sweet and it is going to advise you is we want to from here weekend I did, that is a plus B is because +21 is from here, we can edit A Plus B equals two and avoid a zero. That is because of to A to the power to X. Excellent job minus p into it to the power minus off, Do you know that is the question to twice of a minus or B. That is question too. So by following these two equations So three questions three, he will be close to one, he is one, B is zero. The solution is solution is what it costs to, He is one of the power two weeks place being to be a zero. So so results, bye bye constituted the power works, I hope you understood. Thank you. And the value of artists, too. And one is what.

Alright, Prime number two X squared wide over prime plus X Y prime minus. For a while, I equals zero. Find the journal solution using Ah, the given or other equation. So we'll use our squared plus one ones +10 R minus four equals zero. Do we factor that we get our money? Two times are plus two equals zero So articles to common Negative too. And therefore wise it good too. C one x squared plus you two over.

10 quadratic For our using the quadratic formula, we found that are is a good A one plus or minus. I using this farm. Okay. Why it calls X see one co sign. What next? Let's see to sign.


Similar Solved Questions

5 answers
Tutorial ExercIseFind the vertex of the graph of the equation Sx2 _ * -StopCompare the equationwith the equation ((x) "rIdentify b; andBubnt Skp lyoucannol comg back)"5,2
Tutorial ExercIse Find the vertex of the graph of the equation Sx2 _ * - Stop Compare the equation with the equation ((x) "r Identify b; and Bubnt Skp lyoucannol comg back)" 5,2...
5 answers
@@A (ede] Sampek 3.'€ 405 Ta kmn Ic,4 Lor dcrd Ceuoykn Ca Iuaih Dt Qa SC Ca 51C na 36 4aKt`_ Wtecas ] Ikcaw/ MAklai Sladcd QElia licn A) X :75 Fd dacc 1u Iom 04 MuAnaia
@@A (ede] Sampek 3.'€ 405 Ta kmn Ic,4 Lor dcrd Ceuoykn Ca Iuaih Dt Qa SC Ca 51C na 36 4aKt`_ Wtecas ] Ikcaw/ MAklai Sladcd QElia licn A) X :75 Fd dacc 1u Iom 04 Mu Anaia...
5 answers
OuaaanHeln onedancnintcnks lorthotnooulabon 1 855.70 H ncrmnnonn LD conatnuct Ihu conldencu inbicyuly populabon Menmotho samelnanenndlt Doniktinn shindamidainlion_Wnhle V 1 h doamal 1 36 rouaro onvan tno WmhichlIntananl TRounotoCheck Angi Lal_ 0uE ounanawier ininacdii fields d Enter
OuaaanHeln onedancnintcnks lorthotnooulabon 1 855.70 H ncrmnnonn LD conatnuct Ihu conldencu inbicyuly populabon Menmotho samelnanenndlt Doniktinn shindamidainlion_Wnhle V 1 h doamal 1 36 rouaro onvan tno WmhichlIntananl TRounoto Check Angi Lal_ 0uE ounanawier ininacdii fields d Enter...
5 answers
HW42: Problem Shatus Ao Lat(1Pt)Find the Laplace transform F(s) = c{f(t)}(s)of the fuuction f (t) = Je F(s) = C{se-6 +2t + 7e" }(s) For what values does Ile Laplace Inunsfon exist ?'2t + Tell . defined on the interval t 2 0 help Uormulashelp (une qudtes)Nolc Yol €aPt "arn [utial cradit Ian poblemproyiduaneMusSubrni AnswersYuu have allempted this problem IICA You have unlimited attenipts [euaining
HW42: Problem Shatus Ao Lat (1Pt) Find the Laplace transform F(s) = c{f(t)}(s)of the fuuction f (t) = Je F(s) = C{se-6 +2t + 7e" }(s) For what values does Ile Laplace Inunsfon exist ?' 2t + Tell . defined on the interval t 2 0 help Uormulas help (une qudtes) Nolc Yol €aPt "arn [...
5 answers
9?9x 02 Z voluale J"" 2dz.2 dx Jx0h Setap the dollowrg untegral : Jyctsa Rz9}ho4*4 ! and O282!}
9?9x 02 Z voluale J"" 2dz.2 dx Jx 0h Setap the dollowrg untegral : Jyctsa Rz9}ho4*4 ! and O282!}...
5 answers
In simple linear regression analysis, which of the following is true?None of the answers is correct:The relationship between x and y is represented by line.The F test and the t test may or may not yield the same results_The F test and the test yield the same resultsThe value of F = t2.
In simple linear regression analysis, which of the following is true? None of the answers is correct: The relationship between x and y is represented by line. The F test and the t test may or may not yield the same results_ The F test and the test yield the same results The value of F = t2....
5 answers
The length of time necessary to complete a specific task is exponentially distributed with mean 0.5hrs_ If the task is to be done twice and the time to do the tasks are independent, what is the probability that the total time for these two tasks will exceed 1.5 hours?
The length of time necessary to complete a specific task is exponentially distributed with mean 0.5hrs_ If the task is to be done twice and the time to do the tasks are independent, what is the probability that the total time for these two tasks will exceed 1.5 hours?...
5 answers
Examine that the function f(z)=u+iv=27+72 in the Argand plane, where Z is the conjugate of z and also obtain the points where it is differentiable but its not analytic .
Examine that the function f(z)=u+iv=27+72 in the Argand plane, where Z is the conjugate of z and also obtain the points where it is differentiable but its not analytic ....
5 answers
Suppose the correlation coefficient between FEV for 100 sets of identical twins is $.7,$ whereas the comparable correlation for 120 sets of fraternal twins is .38 .Test for whether the true correlation coefficients differ between these groups. Report a $p$ -value.
Suppose the correlation coefficient between FEV for 100 sets of identical twins is $.7,$ whereas the comparable correlation for 120 sets of fraternal twins is .38 . Test for whether the true correlation coefficients differ between these groups. Report a $p$ -value....
5 answers
The solubility of CaFz when the substance is added to an Match each substance with its effect on aqueous solution of CaFz (Ksp = 1.5 10-10)NaFChooseKCIChoose
the solubility of CaFz when the substance is added to an Match each substance with its effect on aqueous solution of CaFz (Ksp = 1.5 10-10) NaF Choose KCI Choose...
1 answers
Find the exact values of the sine, cosine, and tangent of the angle. $$\frac{5 \pi}{12}$$
Find the exact values of the sine, cosine, and tangent of the angle. $$\frac{5 \pi}{12}$$...
5 answers
Problem 3Consider the reaction: N2 3H2 2NH} The equilibrium constant at 400C K-0.5. Suppose we make concentrations: mixture with the NH] following L.OM [ Nj] = L.OM [ Hj] I.OM In which direction mill the reaction go? I.Nz + 3H2 2NH}2 ZNH} ~> Nz 3H2Problem 4For the reaction: N2 3H2 Kp = K(RT)-2 2 Kp K(RT)- 3. Kp K(RT) / 4.Kp Kc(RT)?2NH3 The relationship between Kc and Kp is:Prcblem
Problem 3 Consider the reaction: N2 3H2 2NH} The equilibrium constant at 400C K-0.5. Suppose we make concentrations: mixture with the NH] following L.OM [ Nj] = L.OM [ Hj] I.OM In which direction mill the reaction go? I.Nz + 3H2 2NH} 2 ZNH} ~> Nz 3H2 Problem 4 For the reaction: N2 3H2 Kp = K(RT)-...
5 answers
Why do you think the structures of proteins are important inbiology or in sustaining life? Using Google or the textbook, lookfor a human protein, which is known for a possible single aminoacid replacement due to a point mutation that alters the proteinstructure. Discuss what happens to the function of the proteinbecause of the mutation and if and how the altered proteinstructure has negative consequences on human health.
Why do you think the structures of proteins are important in biology or in sustaining life? Using Google or the textbook, look for a human protein, which is known for a possible single amino acid replacement due to a point mutation that alters the protein structure. Discuss what happens to the funct...
4 answers
Consider the IVP: yl = 1+ %,1sts2, v(1)=2, h=0.4 use the exact solution Y(d) = t In(d) +2 t,and Adams-Bashforth Two ~Step' Explicit method to approximate y(1.8).a. 4.6580b. 4.672943.27335d.3.27106e. 2.61878f.2619136
Consider the IVP: yl = 1+ %,1sts2, v(1)=2, h=0.4 use the exact solution Y(d) = t In(d) +2 t,and Adams-Bashforth Two ~Step' Explicit method to approximate y(1.8). a. 4.6580 b. 4.67294 3.27335 d.3.27106 e. 2.61878 f.2619136...
5 answers
TUTOR Ow com 0 Submlt Calculate the mass, Molarity:' 8 1 in grams, Mass My Hot Solute 8 of Ni(CH;cOo) MlmftakenssignmenthakeCovalentActivity do?locatorsassignment-take 8 1 L 1 8 exactly 250 3 1 solution 8 of Ni(CH;COO) 2
TUTOR Ow com 0 Submlt Calculate the mass, Molarity:' 8 1 in grams, Mass My Hot Solute 8 of Ni(CH;cOo) MlmftakenssignmenthakeCovalentActivity do?locatorsassignment-take 8 1 L 1 8 exactly 250 3 1 solution 8 of Ni(CH;COO) 2...
5 answers
NamcdiscaseCalises psease Iype of MicrobeSians{Syinmois UeaceHow Dlsease Ts Spread (Transmission}Microbe
Namc discase Calises psease Iype of Microbe Sians{Syinmois Ueace How Dlsease Ts Spread (Transmission} Microbe...
5 answers
The following table contains the observed and expected values for a goodness of fit problem: Calculate the list of (0-E)2/E values that we enter intoL3.0 E1,0.8,0.33,0.251,21,11,-0.4,0.33,0.25
The following table contains the observed and expected values for a goodness of fit problem: Calculate the list of (0-E)2/E values that we enter intoL3. 0 E 1,0.8,0.33,0.25 1,21,1 1,-0.4,0.33,0.25...
5 answers
Nunenical questionThere are 36 nucleotides Ihis mRNA QUCLL Intnis MRNA {equencewetetrinilaled prolein contuintmoduceprolein;hov manyamino acid' noucelnaAGGAGGUGAUGGCAUACAGCCCCUAGGGAUGCCAAA ]"Sudm TerorSenal mesatto Ine |nstouctocAnin Annneraaaln n
nunenical question There are 36 nucleotides Ihis mRNA QUCLL Intnis MRNA {equencewetetrinilaled prolein contuint moduce prolein;hov manyamino acid' noucelna AGGAGGUGAUGGCAUACAGCCCCUAGGGAUGCCAAA ]" Sudm Teror Senal mesatto Ine |nstouctoc Anin Annneraaaln n...
5 answers
Your Do not i8j {8 Question Answer: enter to H uses up 7 (1 metres ia 95 canion) kg: when 'sajeid (+) fire and Calculate leaves - down 3 the . watermelon cannon negative maximum height straight () 23.93 dn 3 Kfrom 8 The Mass ground level; watermelon thee Page ` above the speed 0f 11Previous PageAnswer Next PagePage
Your Do not i8j {8 Question Answer: enter to H uses up 7 (1 metres ia 95 canion) kg: when 'sajeid (+) fire and Calculate leaves - down 3 the . watermelon cannon negative maximum height straight () 23.93 dn 3 Kfrom 8 The Mass ground level; watermelon thee Page ` above the speed 0f 11 Previous ...

-- 0.019083--