5

Mherwo Warming and Ice Melt The average depth of the L. Hudson Bay is 305 feet: Climatologists were interested_ in seeing if warming and ice melt were affecting th...

Question

Mherwo Warming and Ice Melt The average depth of the L. Hudson Bay is 305 feet: Climatologists were interested_ in seeing if warming and ice melt were affecting the water level.Fifty-five measurements period of randomly selected weeks yielded a over smple mean of 306.2 feet; The population variance is known to be 3.6. Can it be concluded at the 0.05 level of 'significance that the average depth has increased? Is there evidence of what caused this to happen? Source: World Almanac and Book o

mherwo Warming and Ice Melt The average depth of the L. Hudson Bay is 305 feet: Climatologists were interested_ in seeing if warming and ice melt were affecting the water level.Fifty-five measurements period of randomly selected weeks yielded a over smple mean of 306.2 feet; The population variance is known to be 3.6. Can it be concluded at the 0.05 level of 'significance that the average depth has increased? Is there evidence of what caused this to happen? Source: World Almanac and Book of Facts 2010.



Answers

Global Warming? During the late 1800 s, Lake Wingra in Madison, Wisconsin, was frozen over an average of 124.9 days per year. A random sample of eight recent years provided the following data on numbers of days that the lake was frozen over. $$\begin{array}{llllllll}\hline 103 & 80 & 79 & 135 & 134 & 77 & 80 & 111 \\\hline\end{array}$$ At the $5 \%$ significance level, do the data provide sufficient evidence to conclude that the average number of ice days is less now than in the late 1800 s?

39 talks about the area, the minimum size of the ice cap the area has given us by our square where R is the radius. Now we're given that in 2005 the radius is 808 In 2005 the radius is, uh, 08 miles on. The rate of change of radios is 4.3 miles per year. Based on this information, we need to find the rate of change off area. So that's respectful times. If we differentiate this with respect to time, why is a conference that comes outside the transition of artists whereas to RDR over details in the power change rule eso This will be to buy our Zeta weight and they are what it is. Four point trees. If we calculate this, we have the rate of change off area as, uh, just come orders to 1830.29903 So this is the rate at which the area is changing with respect to die

So we knew that for linear thermal expansion, the change in length would be equal to the linear thermal expansion coefficient times the original length most applied by the change in temperature. Delta T. We can say that the change in volume is very nearly change in volume, equaling three times Alfa the linear expansion coefficient times the original volume times the change in temperature. And so we're going to say that ah three Alfa simply equals beta. So this would be beta times the original volume times the change in temperature. And so we can then say that the linear expansion or the change in length in terms of beta would be equaling two beta over three multiplied by the length times the change in temperature and so we can then solve the change in length would be equaling two, 210 times 10 to the negative six. This would be the volume expansion coefficient for water per degree Celsius. This would again be divided by three multiplied by the original length of one kilometer or 1000 meters multiplied by the change in temperature of one degree Celsius. And we have a change in length of 0.70 meters. This would be our final answer. That is the end of the solution. Thank you for watching.

Well, we know. Did, uh, changing land is equal to l for times l times, adult et I will. The terminal question to expansion of border is, um El phone is equal to beater divided by three. And that is equal to 210 times 10 to the power minus six. Divided by three. That is 70. Multiply by 10 to the power of minus six. Birdie percent agreed. So we're degree centigrade both to calculate the change in length off the column of water. We substitute the values of Alfa. L intend temperature so delta hell is equal to 70. Multiply by 10 to the dollar minus six. Looked like the one multiplied one that is able to 70 Will took my by 10 to the dollar minus six kilometer. Right? So we arrived to the final result. I don't l is equal to 70 multiplied by 10 to the power. Um, minus six kilometer date is equal to seven centimeter

All right, You've got a pretty realistic problem here. Global warming is a serious issue. And, ah, it has been shown to produce rising sea levels partly due to the fact that there's the melting ice caps and also partly due to the to the expansion of water as the average ocean temperature rises. So to get some idea of this ah effect we want to do is calculate the change in length of a column of water that is one kilometer high. So we're gonna see we have a length equal to one kilometer and it has a temperature increase delta t equal to one degree Celsius. We want assumed the calm is not free to expand sideways, which, as a model for the ocean, this is very reasonable because the oceans really only going to going to expand sideways as it gets closer to the shore. And at that point also only to a very limited, limited degree. Um, and also as tell. But this approximation, we're gonna going to, ah, to collect the fact that the the ocean warming is not uniform with depth. So, first of all, we need to find the coefficient of laying your thermal expansion of water because we are assuming that the water is constrained to a cylinder but unconstrained length so we can find that from from wide variety of sources, uh, to actually find that coefficient. So let's start here. We know the volume thermal expansion of water. We know that we can have beta equals three times Alfa. And here this is the beta of water and this is equal to three times thermal expansion. Alfa of water. So, just for brevity, I'm going to remove my waters here. So we have our Alfa, which is equal than two beta over three, which is equal to 210 times 10 to the minus 6/3, which gives us a thermal expansion coefficient for water. He called to 70 time standing the minus six degrees Celsius, the negative one. So we have that value and we can actually now use it in the next step here. So to find out that change length, we know delta L is equal to the length initial times that coefficient multiplied by the change in temperature. That length initial is 1000 meters that coefficient initials. What we just found above which is 70 70. I'm sending the negative six and the Delta T, which is just one. This gives us a delta l change of length equal to 7.0 times stand to the minus two meters.


Similar Solved Questions

5 answers
Chapter 12 Problem 082siellia ellipiical orbit wich petioj ~rqMiz( #DeLJ 3t perihcliun?11 ;ahuuiplrivat Inetu1024 Icy_ Ai phziotAdliug9 7 10' m iie g3te ite - 3rigul' #OEBU 7.046 10- rad/u WhatNunaberUnlcThe number of significant digits set to 3; the tolerance +/-496 Tllek 'as)r Idl Iika nnvar Wcik fot his NWaSII: Qpen_Shor_Work
Chapter 12 Problem 082 siellia ellipiical orbit wich petioj ~rqMiz( #DeLJ 3t perihcliun? 11 ; ahuui plrivat Inetu 1024 Icy_ Ai phziot Adliug 9 7 10' m iie g3te ite - 3rigul' #OEBU 7.046 10- rad/u What Nunaber Unlc The number of significant digits set to 3; the tolerance +/-496 Tllek '...
5 answers
Usu Ine propenie ?logarithms write the expressionsinm . diherenceproduncal ximplet oqaninms For example, log 2 (Vx)log23 - log2*.
Usu Ine propenie ? logarithms write the expression sinm . diherence produncal ximplet oqaninms For example, log 2 (Vx) log23 - log2*....
5 answers
Given f(r) = (2x-1)%_ find the absolute minimum and maximum values on [0, 1].Absolute Minimum:Absolute Maximum:
Given f(r) = (2x-1)%_ find the absolute minimum and maximum values on [0, 1]. Absolute Minimum: Absolute Maximum:...
5 answers
Chopter Review Exercises, Question Trcdactive meta weighs grams and 10se5 290 of its mass CVeyhout Wnteexpression that dcscribesweightgrumytultehoutsEnter the exact answerNote that "Walready provided Do not include ths vour submitted responscquestionEdlt
Chopter Review Exercises, Question Trcdactive meta weighs grams and 10se5 290 of its mass CVeyhout Wnte expression that dcscribes weight grumytulte houts Enter the exact answer Note that "W already provided Do not include ths vour submitted responsc question Edlt...
5 answers
Draw the major product expected from the following reactionsCOzCH3COzCH3OCH3 heatHeatHeat
Draw the major product expected from the following reactions COzCH3 COzCH3 OCH3 heat Heat Heat...
5 answers
The following is a transcription unit from a gene where the top strand is the coding strand:5'ATTCTAGCTAGCATGCTACGATGCTTTACAAGCGCGTACGCCAACGCATACGATGCATATAAGTACTAA3' 3'TAAGATCGATCGTACGATGCTACGAAATGTTCGCGCATGCGGTTGCGTATGCTACGTATATTCATGATTSThe protein that is synthesized from this DNA is MET-LEU-ARG-CYS-PHE-THR-SER-ALA-TYR-VAL-ARG-CYS-ILEA There is an intron in this gene: Label the start codon; the stop codon and circle the intron:
The following is a transcription unit from a gene where the top strand is the coding strand: 5'ATTCTAGCTAGCATGCTACGATGCTTTACAAGCGCGTACGCCAACGCATACGATGCATATAAGTACTAA3' 3'TAAGATCGATCGTACGATGCTACGAAATGTTCGCGCATGCGGTTGCGTATGCTACGTATATTCATGATTS The protein that is synthesized from this DNA...
5 answers
Solve and check.$$-8=n+1$$
Solve and check. $$-8=n+1$$...
5 answers
Determine convergence or divergence of the alternating series.14) 0 5n + 2 E (-1pnin In + [ n=[ A) ConvergesB) Diverges
Determine convergence or divergence of the alternating series. 14) 0 5n + 2 E (-1pnin In + [ n=[ A) Converges B) Diverges...
5 answers
Give the odd extension of f(a) = sin(c/2) defined on the interval (0, 7) and find its Fourier-sine series Where does this series converge as x T and € - 0 (explain)?
Give the odd extension of f(a) = sin(c/2) defined on the interval (0, 7) and find its Fourier-sine series Where does this series converge as x T and € - 0 (explain)?...
5 answers
Solve the differential equation: Edy V+x+y+1y 1dObtain the reduction fonnula for I, =| sindx hence Or otherwise. show thatsin' rcos.1" dx =SLT COs:114 = (sin" 1+C
Solve the differential equation: Edy V+x+y+1y 1d Obtain the reduction fonnula for I, =| sin dx hence Or otherwise. show that sin' rcos.1" dx = SLT COs:1 14 = (sin" 1 +C...
5 answers
PROBLEMSState how the ~inicutcy Cach of the following plirs are related tO cuch othcr: Tliey may be constitudional (structural) isomets enantlomety daucomcr or the We compuundCI HO-Ca OHFH:HicyCCHcucmcilCCH (I:ch,~SlI CHZCHOHlCIICHiOHlCHCCH {#:Tch Ie LAt CI:CH CILCHICHOHICHA OH
PROBLEMS State how the ~inicutcy Cach of the following plirs are related tO cuch othcr: Tliey may be constitudional (structural) isomets enantlomety daucomcr or the We compuund CI HO- Ca OH FH: Hicy CCH cucm cil CCH (I:ch, ~SlI CHZCH OHl CIICHi OHl CHCCH {#:Tch Ie LAt CI:CH CILCHI CH OHI CHA OH...
5 answers
Compound A and B are constitutional isomers. This type of compound is called allenes. One compound is chiral and other one is achiral. Determine which is chiral and explain your answer:CH;AjOl C HyCH;omg
Compound A and B are constitutional isomers. This type of compound is called allenes. One compound is chiral and other one is achiral. Determine which is chiral and explain your answer: CH; AjOl C HyC H;omg...
5 answers
Pts) A laddler [7 ft . long rests against vertical wall; If the bottom of the lakdler slides awAV from the wall at rate of fc. | Sc€, how fast is the top ofthc Iackdler sliding down the wall when the bottom of the Indder is From te wall? Do uot forget to state the variables, which quantities are given and which ones YOu Ilerxl t0 fitd: state the relatiouship betwecn the vurinbls.
pts) A laddler [7 ft . long rests against vertical wall; If the bottom of the lakdler slides awAV from the wall at rate of fc. | Sc€, how fast is the top ofthc Iackdler sliding down the wall when the bottom of the Indder is From te wall? Do uot forget to state the variables, which quantities a...

-- 0.022594--