5

4 Mwfmal purip Gamzlzlz hzat cuzrgy fton () Deceruci : cie, Oje gniple iz:czlal fIol/ &jz? hci/cold/iidg? ecld fIb/car engine 6d) mcwe 0 Nie aboje...

Question

4 Mwfmal purip Gamzlzlz hzat cuzrgy fton () Deceruci : cie, Oje gniple iz:czlal fIol/ &jz? hci/cold/iidg? ecld fIb/car engine 6d) mcwe 0 Nie aboje

4 Mwfmal purip Gamzlzlz hzat cuzrgy fton () Deceruci : cie, Oje gniple iz: czlal fIol/ &jz? hci/cold/iidg? ecld fIb/car engine 6d) mcwe 0 Nie aboje



Answers

$$ 6 z, 3 w^{2}, 1,6 z^{2}, 4 z, w^{2} $$

Okay now let's look at this problem. This problem number 40. Okay so here first let's find the value of Z. N. W. Okay so we know this is an exponential form. So this is our this is C. To. Okay so uh and for w this is our and this is sita okay so now let's find uh lead times W. So daytime's W. Goes to two E. I. To the form Pi minus over nine times 6 E. I. To the temp i overnight. Okay so here we have 12th house E. 14 Pi over nine times I. Okay so uh now let's rewrite this in the polar form. So these are this is data. Okay so we have our times casa in Ceta plus I say to times I. Okay now let's find the value of Z. Over W. Can they over W. E. Costa? Mhm. Okay so we have 1/3 times into the eye. four Pi over 9 -10 Pi overnight. Okay so we have one third times E. To the -6 Pi over nine times I. Okay. Okay so which it goes to 1/3 times into the minus two pi over three times I. Yeah. Okay so let's write this in the polar from this are this state? Okay so we have our times call science data plus I size say that times I. Okay so we we know that argument must uh you know between 20 and two pi. Okay so we add two pi to this uh argument. So minus 22 pi over three plus two pi equals to four pi over three. Okay so here we have one third times coastline. Four pi over three. Class site four pi over three times I. Okay so here let's move it let's modify a little bit our exponential form. So here I have one third one third times E. To the four pi overstressed power For for power three times eyes power. The yeah

Okay, now let's look at this problem number 39. Okay. We have the Z. And W. So first we want to find Z. W. And Z. They divided by W. Okay, so let's find the value of Z. one Let's write this in the exponential form. Okay, we know this is our and this is a visa. Okay, so we have uh okay, so it's already in exponential form. Okay. Actually we can just continue to find the time step. Okay, let's go ahead. So the times w it goes to three times into the eye, 13 pi over 18 times four times into the I times three pi over two. Okay, so this is it goes to 12 times e. To the 13 pi over 18 plus. Okay, so I times 13 pie over 18 plus. I'm times three pi over two. Okay, so now here we have 12 times E. To the 40 pi over 18 times i. Okay, so So 14 pi over 18, actually it goes to 20 pi over nine. Okay so here we can also write as 20 pie overnight. Okay so now let's write this is a polar form. Okay so this is our and this is data. Okay so we have our times coastlines data plus sign Ceta times I. Okay so now let's find the over W. Okay so the sorry they divided by W. Okay so I have Z. Is yeah And I have w equals two. Yeah. Okay. Which is equals two. 3/4 times E. To the 13 pi over 80 three pi over two times I. Okay so we have 3/2, 3/4 times eat to the minus 14 pie over 18 times I. Okay. Okay so now let's write this in the polar form. So this are this is data. Okay so we have our times cause I say to plus sign Ceta Times I. Okay so actually we can change it into 7/9. Okay this is also sign 7/9. But here notice the argument must be between 0-2 pi. Okay it can be a negative number. Okay so let's change it. So we know that co sign of -7 point overnight where you can uh We can plus two pi and so Make it two equals to the original. OK so we have Okay so I will write here -7 pie. Okay so what I mean is cause I two pi plus X. It goes to court side X. Right? and sign of two pi plus uh two pi plus x. You cause to sigh X. Okay so I will add a two pi here. So makes it two straight over four times clothes line. So uh minus seven pi over nine. We add two pi equals two Because I 11 pi over nine Plus sign of 11 pie overnight times. I Okay, so from here, actually, we can go back to the exponential form. Okay, This this here City is also minus. Okay, we want to change it to positive. So I have here is 3/2 times. E to the Here status. 11 pi over that. Okay. Times. Okay, So we now turn this to into positive.

And this problem we're being asked to multiply the mono meal for W squared by the triangle meal three W to the third minus two w squared minus w. To do this, I'm going to use the distributive property. So first we need to multiply for w squared by the first term three w to the third, which will give us 12 w to the fifth hour. Next, we're going to multiply for w squared by the second term negative to W squared which will give us negatives which will give us negative eight w to the fourth And lastly, we need to multiply for w squared by the last term. Negative w Well, that's going to give us negative four w to the third and now because none of these

For this question. We first rewrite any of these this time with an operator he he caused to D over DT and the relabel with by question one you question true in the equation. Great. So first we use the question, um, one miners twice off the equation, too, And it gives us G minus four x minus to the minus. AIDS. Why you close is here. And, uh, for you Question Twin cushion three. I would want to eliminate the Z parts here, so we use an operator theme minus four. Acting only question to and we're not pry everything by tweeting equation. The reasons for X eight y press twice off the miners for Z zero, which allows us to eliminate the easy part. You. So, um, this to a question gives us for X prayers. Eight miners b minus for a square acting on Why you question zero. Okay, so we can see there equation for in the Christian five. Um, so we do the same thing. We try to eliminate one off this X or why, in this case we use and this operator in fact, this operator, Yukos Teoh miners The square minus eight p prostate. Okay, so for your question, for we used this operator acting with it and the fourth equation of five. Um, we use the operator to G minus eight. Hectic diet. So this of the system allows us to really make why. So we just want some trick the other. And now we have e times B minus AIDS terms B minus for acting on my X equals zero. So this is a homogeneous all of the onda. Since we already factored the operating this way, that means the characteristic equation will be our times ar minus eight times our minds. For Yukos zero, Andre has three distinct solution. That means a general surgeon for ex service C one plus e to into the eighth T press. See the rate 30 40? I guess the ones we so four x way. Look back. The only know equation. Any question One The only contents x and Z. So we can directly off 10. The solution for Z the goes to minus one or four B minus for 18 weeks and that gives us the questions. You are minus C two, e two, the 18 and once we solve for X and Z, we look back the equation again for your question three because you contest both X y z so we can use the information for eggs and Zito. So for why so Why? Because too minus two x minus g minus for acting on the and it divided by four. So prodding this X and Z we have Why cross the one have C one plus one have sea to Italy, 80 minus one Have C three you to the 14 and then this soft this system for the


Similar Solved Questions

5 answers
What is the pH of a solution prepared by mixing 32.1 mL of 0.183MKOH and 32.1mLof 0.145 MHCl is at 25 "C?
What is the pH of a solution prepared by mixing 32.1 mL of 0.183MKOH and 32.1mLof 0.145 MHCl is at 25 "C?...
5 answers
Determine whether the following sequence converges or diverges. If it converges, find its limit8n + ( - {an} = 2nSelect the correct choice below and fill in any answer boxes within your choice.0A. The sequence converges: The limit is 0 B. The sequence diverges.
Determine whether the following sequence converges or diverges. If it converges, find its limit 8n + ( - {an} = 2n Select the correct choice below and fill in any answer boxes within your choice. 0A. The sequence converges: The limit is 0 B. The sequence diverges....
5 answers
Tutorial ExerciseEvaluate the integral. X-2 K Vx aXStepTo find an antiderivative ofwe will first rewrite the fraction as1/212 * 'x-1/2Step 23/21/2Now,['42 Vx dx = K x2 _ 2x-1/2 dx3/23/2Step 3Simplifying gives 2/32/3 x3/2xl2]Step 4Remember that 91/2 = Vg = 3 and that ab/c = (al/c)b in order to evaluate the following [4_ dx = [3 *n - 4x1z],)-(3 -4)Submit Skip (you cannot come back)1/2
Tutorial Exercise Evaluate the integral. X-2 K Vx aX Step To find an antiderivative of we will first rewrite the fraction as 1/2 12 * 'x -1/2 Step 2 3/2 1/2 Now, ['42 Vx dx = K x2 _ 2x-1/2 dx 3/2 3/2 Step 3 Simplifying gives 2/3 2/3 x3/2 xl2] Step 4 Remember that 91/2 = Vg = 3 and that ab/...
5 answers
The mother is heterozygous for type A blood and the father is heterozygous for type blood B. Use alphabets to answer the question_ when required: What is the genotype of the father? What is the genotype for mother? What is the probability of inheriting genotype 0 in the offspring? What is the probability of inheriting genotype A in the offspring?
The mother is heterozygous for type A blood and the father is heterozygous for type blood B. Use alphabets to answer the question_ when required: What is the genotype of the father? What is the genotype for mother? What is the probability of inheriting genotype 0 in the offspring? What is the probab...
5 answers
Suppose a projectile is launched from an initial height $s_{0}$ at an angle of elevation $heta$. If air resistance is ignored, show that the horizontal range is given by$$R=frac{v_{0} cos heta}{g}left(v_{0} sin heta+sqrt{v_{0}^{2} sin ^{2} heta+2 s_{0} g}ight).$$Note that when $s_{0}=0$ this formula reduces to the range $R$ given in Problem 17 .
Suppose a projectile is launched from an initial height $s_{0}$ at an angle of elevation $ heta$. If air resistance is ignored, show that the horizontal range is given by $$ R=frac{v_{0} cos heta}{g}left(v_{0} sin heta+sqrt{v_{0}^{2} sin ^{2} heta+2 s_{0} g} ight). $$ Note that when $s_{0}=0$ thi...
5 answers
The characteristic method can be used to solve any first order PDESelect one: TrueFalse
The characteristic method can be used to solve any first order PDE Select one: True False...
1 answers
Consider the following functions $f$. a. Is $f$ continuous at (0,0)$?$ b. Is $f$ differentiable at (0,0)$?$ c. If possible, evaluate $f_{x}(0,0)$ and $f_{y}(0,0)$. d. Determine whether $f_{x}$ and $f_{y}$ are continuous at (0,0). e. Explain why Theorems 15.5 and 15.6 are consistent with the results in parts $(a)-(d)$. $$f(x, y)=\sqrt{|x y|}$$
Consider the following functions $f$. a. Is $f$ continuous at (0,0)$?$ b. Is $f$ differentiable at (0,0)$?$ c. If possible, evaluate $f_{x}(0,0)$ and $f_{y}(0,0)$. d. Determine whether $f_{x}$ and $f_{y}$ are continuous at (0,0). e. Explain why Theorems 15.5 and 15.6 are consistent with the results ...
5 answers
5.00 g of hydrate of CoClz is strongly heated. After cooling, anhydrate has a mass of 3.27 gSHOW CALCULATIONS for each part:a) How many grams of water were lost?b) Calculate % of water lost.c) What is the formula for hydrate of CoClz?
5.00 g of hydrate of CoClz is strongly heated. After cooling, anhydrate has a mass of 3.27 g SHOW CALCULATIONS for each part: a) How many grams of water were lost? b) Calculate % of water lost. c) What is the formula for hydrate of CoClz?...
5 answers
15 0f 15 (13 complete)14.1.64 Find an equalion for Ihe leval surface of the function through given point X+Y-z" (2,0, - 3)An squallon for the levol surlace passing through the point (2.0,- 3) i5 2 =
15 0f 15 (13 complete) 14.1.64 Find an equalion for Ihe leval surface of the function through given point X+Y-z" (2,0, - 3) An squallon for the levol surlace passing through the point (2.0,- 3) i5 2 =...
5 answers
Q2. Find the transition matrix representing the change of c0 ordinates on Pz from the ordered basis {1,1,22} t0 the ordered basis {1,31, 2 1}_
Q2. Find the transition matrix representing the change of c0 ordinates on Pz from the ordered basis {1,1,22} t0 the ordered basis {1,31, 2 1}_...
2 answers
9_ Determine whether or not thc sct S is a basis for the specified vector space V. Fully supp answcr: V=R'; ; s ={[1,1,0], [1,2,3] [-2,1,-1}}S={t+3,0_1,202_t-5}b_ V =P;C. V =R2; s={[4,-6], [-10,15}}
9_ Determine whether or not thc sct S is a basis for the specified vector space V. Fully supp answcr: V=R'; ; s ={[1,1,0], [1,2,3] [-2,1,-1}} S={t+3,0_1,202_t-5} b_ V =P; C. V =R2; s={[4,-6], [-10,15}}...
5 answers
KV (s) (Js + b)(Ls + R) + K2
K V (s) (Js + b)(Ls + R) + K2...
5 answers
Consider the following mRNA sequence:5’—AACGCAUGCUUCCCUAUAAGCGC— 3’A point mutation occurred to change the original mRNA sequenceinto this… 5’—AACGCAUGCUUCCCUAAAAGCGC — 3’Translate both mRNA sequences (before and after the mutation)into their corresponding amino acids. Use the chart below. Indicatewhich strand is which in your answer.
Consider the following mRNA sequence: 5’—AACGCAUGCUUCCCUAUAAGCGC— 3’ A point mutation occurred to change the original mRNA sequence into this… 5’—AACGCAUGCUUCCCUAAAAGCGC — 3’ Translate both mRNA sequences (before and after the mutation) i...
5 answers
TRUE/FALSE: Let F be a field, let m(x) ∈ F[x] be irreducibleover F, and R = F[x]/〈m(x)〉. It is possible that the ring Rcontains zero divisors.
TRUE/FALSE: Let F be a field, let m(x) ∈ F[x] be irreducible over F, and R = F[x]/〈m(x)〉. It is possible that the ring R contains zero divisors....
5 answers
How many gallons of a 60% antifreeze solution must be mixed with70 gallons of 25% antifreeze to get a mixture that is 50%antifreeze?
How many gallons of a 60% antifreeze solution must be mixed with 70 gallons of 25% antifreeze to get a mixture that is 50% antifreeze?...
5 answers
Activity Factors that affect the entropy of a system_List all the factors that allect the amount of entropy of a system and describe how cach of them docs sO.
Activity Factors that affect the entropy of a system_ List all the factors that allect the amount of entropy of a system and describe how cach of them docs sO....

-- 0.020403--