5

Which of the following is not an example of homeostasis :a. a rise on the blood pressure in the aorta triggers mechanisms to lower the aretrial pressure. b. a rise...

Question

Which of the following is not an example of homeostasis :a. a rise on the blood pressure in the aorta triggers mechanisms to lower the aretrial pressure. b. a rise in the levels of Calcium in the blood triggers a hormone that reduces the levels of calcium in the blood. c. a rise in the estrogen hormone during the menstrual cycle risses the number of receptors of the porgesterone in the uterus. d. a rise in the blood sugar stimulates the release of a hormone in the pancreas that stimulates cells

which of the following is not an example of homeostasis :a. a rise on the blood pressure in the aorta triggers mechanisms to lower the aretrial pressure. b. a rise in the levels of Calcium in the blood triggers a hormone that reduces the levels of calcium in the blood. c. a rise in the estrogen hormone during the menstrual cycle risses the number of receptors of the porgesterone in the uterus. d. a rise in the blood sugar stimulates the release of a hormone in the pancreas that stimulates cells in the body to lower the blood sugar levels. e. a reduction en the body temperature triggers a neural response that initiates physiological changes to increase the body temperature.



Answers

Which of the following best illustrates homeostasis? (Explain your answer.) a. Most adult humans are between 5 and 6 feet tall. b. All the cells of the body are about the same size. c. When the salt concentration of the blood goes up, the kidneys expel more salt. d. When oxygen in the blood decreases, you feel dizzy.

When you think about home eo Stasis, you're talking about principles that are trying to create a steady state within the internal environment of an animal. So that's kind of the interplay between the external environment, which is causing changes. An internal environment designed to regulate those changes. So, of each of these potential answers, expelling salt is something that's getting rid of Excel salt with excess. Um, through you're in going through the kidneys to excel more salt that is trying to create a more steady state when there's too much salt in the system, so maintains a more constant internal environment.

So what is this word that's really important? Thio Organisms and their survival home? Yo, Staci, So home. Your stasis is basically a certain type of process, and this process is one where we're making constant adjustments. So process of constant adjustments and the reason we're making those constant adjustment in the in the organism is so that we have something and can maintain the body fluctuations within a certain range. And what this basically means is that, for example, if I get too hot, my body temperature fluctuates. Um, if it gets too hot, I could die. But to make sure that I don't dye my body makes constant adjustments, which is what home your stasis is. It goes through a process of home. Eustace is allowing, um, my body to sort of cool off, either by panting or sweating or something of the sort to make sure that my body fluctuations it. Even though they fluctuate, they stay within a certain range. This is really important. However, we can narrow out some of the answer choices because one of the answer choices says that it's by behavioral change and behavioral change. Behavioral changes are not always the case not always So. For example, sweating is something that's not necessarily a behavior is just something that your body naturally does. Um, and then another way we can out some of the answer choices is it says that. Is that there? One where it says that there are no fluctuations. That's not the case. Fluctuations are allowed. Fluctuations. Are you okay? Because if that was true, then our temperatures would never change. We wouldn't ever feel pain. Nothing would ever be the same. But this equilibrium that we're at is a dynamic equilibrium, meaning that it's all right. It's all ready for a body to fluctuate. All right, thank you.

Think about what home eo Stasis means. So what is home use stays is well, that's a tendency towards a relatively stable equilibrium between independent elements, and that's he maintained by physiological processes. So in biology home Eos days this is the state of steady internal, physical and chemical conditions that are maintained by systems. So when we look at these possible answers, when there's too much water in the blood than the expulsion of the water helps to have a stable equilibrium or a steady condition of the amount of water in the blood.

So today. Other question that we're asking is if which of these falling choices are an example of what we like to call negative feedback, Um, and that is carried out by the endocrine system. So before we get into the answer choices, let's get with these words mean so negative Feedback is a type of loop in which the animal is trying to maintain a certain level or within certain parameters, so to make sure things are not to hire not too low but stay at the same point. So if it gets too, for example, of a temperature, vampirism gets too hot, then the loop makes it cool down. Um, if it gets too cold and it makes it heat up so it stays within certain parameters. So this is a negative feedback loop. Um, if we look at an endocrine system, this is where hormones and chemicals are released by the body to regulate internal processes, and so that's typically with endocrine system is in charge of. So we look at the answer choices on Lee. The 1st 3 are types of Lucques, so only a, B and C are types of loops. The 1st 1 is a positive feedback loop and that it keep the loop keeps going instead of reverting back to what it used to be. So that is wrong so we can cross out, eh? If we take a look at BNC these air both, Um, if we look at BNC, these are both negative feedback loop. So we have to see which one is an endocrine system. So the 1st 1 is about how glucose levels, um, are modified after meals by insulin. And the second on DSI is about when there is a behavior change because of the, uh, air the atmosphere around when someone is in high altitudes. So this is a behavioral change. So this is behavioral, but B is glucose, which means its internal, so we can see that beat is the right answer because of the fact that that's the one done by the endocrine system. Thank you.


Similar Solved Questions

5 answers
9 ? 600 g 1 8 IH M 3 1 I 1 W 1 1 { Ml 1 8 I 1 I 1 1 U E V Ii U MM 1 1 2 1 1 2 7 J 1 H 1 V 1 M 1 W 8 [ 1 P H L E 1 83 8 1 1 100 6 1 2
9 ? 600 g 1 8 IH M 3 1 I 1 W 1 1 { Ml 1 8 I 1 I 1 1 U E V Ii U MM 1 1 2 1 1 2 7 J 1 H 1 V 1 M 1 W 8 [ 1 P H L E 1 8 3 8 1 1 1 0 0 6 1 2...
5 answers
For the graph shown, identify a) the point(s) of inflection and b) the intervals where the function is concave Up or concave downa) The point(s) of inflection is/are (Type an ordered palr: Use comma t0 separate answers as needed:)
For the graph shown, identify a) the point(s) of inflection and b) the intervals where the function is concave Up or concave down a) The point(s) of inflection is/are (Type an ordered palr: Use comma t0 separate answers as needed:)...
5 answers
Following Elcna Calculatc _ H Elena Lall "392 incncs 1 1 ac [8 arongst bor students 1 31 H Detd uheeCalculate - statistcCalculate the What percentage - What percentigc standard 1 of girls 1 of the ssnonci IEd MIC tlcr tnnIcun than Elena (bclow J4uc) cune)? 1
following Elcna Calculatc _ H Elena Lall "392 incncs 1 1 ac [8 arongst bor students 1 31 H Detd uhee Calculate - statistc Calculate the What percentage - What percentigc standard 1 of girls 1 of the ssnonci IEd MIC tlcr tnnIcun than Elena (bclow J4uc) cune)? 1...
5 answers
Given the following functions, evaluate each of the following: f(z) 129(z) = I | 2(f + 9)( 3)(f - 9)( 3)(f . 9)( 3)Question Help:VideoMessage irstructorSubmit Question
Given the following functions, evaluate each of the following: f(z) 12 9(z) = I | 2 (f + 9)( 3) (f - 9)( 3) (f . 9)( 3) Question Help: Video Message irstructor Submit Question...
5 answers
Deierine the area below fkx) = * + 3and g(x) = 3+2x -x},tut above h(x) = -x+3Delentine te area Under thc curve f(x) = -3x + 4 interval [0, 10[Delenin lc urca blweca lhe funclion fl)-3r+4and the y-axis 0n the y-interval [0,
Deierine the area below fkx) = * + 3and g(x) = 3+2x -x},tut above h(x) = -x+3 Delentine te area Under thc curve f(x) = -3x + 4 interval [0, 10[ Delenin lc urca blweca lhe funclion fl) -3r+4and the y-axis 0n the y-interval [0,...
5 answers
Rxn oejectoroving zicnz straight line has the acceleration function a (t) = ~9.8 initial velocity v (0) = 15 and inltial posltion 2 (0) = 1 with units of measure of meters and seconds_ai Flad %he velocity functionU6rt #eFodcn turtror
Rxn oejectoroving zicnz straight line has the acceleration function a (t) = ~9.8 initial velocity v (0) = 15 and inltial posltion 2 (0) = 1 with units of measure of meters and seconds_ ai Flad %he velocity function U6rt #eFodcn turtror...
5 answers
Write each relation as a set of ordered pairs.
Write each relation as a set of ordered pairs....
5 answers
Finl tc litur approxituation to f(r) sin j M( j = approximale sin(~0.01). Compultethe percemt eTEOt Yole apprexituat iou, [ Apmorimation cract lla rectl, wlere "Xaltt Vatlue given by caleulatof.Uae liucar approxutatiOu etimate V11 Cotpune the pTEVIt Wm A "pproximatiou, I(K) Aporumataon 6ud leroct[:
Finl tc litur approxituation to f(r) sin j M( j = approximale sin(~0.01). Compultethe percemt eTEOt Yole apprexituat iou, [ Apmorimation cract lla rectl, wlere "Xaltt Vatlue given by caleulatof. Uae liucar approxutatiOu etimate V11 Cotpune the pTEVIt Wm A "pproximatiou, I(K) Aporumataon 6...
5 answers
+3Qa-2Q-2QThree particles are located at (O,a), (a,0) and (-a,0) with charges shown in the figure Assuming a= 1 m, Q= 1uC and k= 9x10? N.m?/c?a) (10 points) Find the force on particle 1, namely the magnitude and direction of the force vector. b) (10 points) Find the electric field vector at point 0 (10 points) Find the electrostatic potential at point 0
+3Q a -2Q -2Q Three particles are located at (O,a), (a,0) and (-a,0) with charges shown in the figure Assuming a= 1 m, Q= 1uC and k= 9x10? N.m?/c? a) (10 points) Find the force on particle 1, namely the magnitude and direction of the force vector. b) (10 points) Find the electric field vector at poi...
5 answers
DFhe V-ALIS 1dy integral (6 ESOJ Lie ~ct the 3 cuClosc @Valuate dx TS [ J 1 (u + ] Grccn Usc 4 4 2 1 witre,JNiS 9
D Fhe V-ALIS 1 dy integral (6 ESOJ Lie ~ct the 3 cuClosc @Valuate dx TS [ J 1 (u + ] Grccn Usc 4 4 2 1 witre, JNiS 9...
5 answers
Giv te mechanism lor thc Ieection btween |-tethyk- [-cyclobuarel ad hydrochlonc Kid5.Drew and name ell Suncturel isomers of te fonrl C Hie
Giv te mechanism lor thc Ieection btween |-tethyk- [-cyclobuarel ad hydrochlonc Kid 5.Drew and name ell Suncturel isomers of te fonrl C Hie...
5 answers
What is the molarity of a solution of KSCN if 19.80 mL arerequired to titrate the silver in a sample of an alloy whichcontains 90.20% Ag and 9.80% Cu?a. 0.0422M b. 1.608M c. 0.0258M d. 0.0844M
What is the molarity of a solution of KSCN if 19.80 mL are required to titrate the silver in a sample of an alloy which contains 90.20% Ag and 9.80% Cu? a. 0.0422M b. 1.608M c. 0.0258M d. 0.0844M...
5 answers
[3] The four vectors~=[4 ~-[HJ ~[HJ span subspace V of R: but are not basis for V Choose subset of {V1, V2, V3; VA} which forms basis for V. Extend this basis for V to basis for R:_
[3] The four vectors ~=[4 ~-[HJ ~[HJ span subspace V of R: but are not basis for V Choose subset of {V1, V2, V3; VA} which forms basis for V. Extend this basis for V to basis for R:_...
5 answers
A. How many times does the string CGCG appear in the longerstring?Compute Count(CGCGATACGTTACATACATGATAGACCGCGCGCGATCATATCGCGATTATC,CGCG).Extra Credit: Can you propose pseudo code to accomplishthis?B. Define what a k-mer is. What is the most frequent 3-merof TAAACGTGAGAGAAACGTGCTGATTACACTTGTTCGTGTGGTAT ?C. What is the reverse complement of GATTACA? Explain why it issignificant to find reverse complementary k-mers
A. How many times does the string CGCG appear in the longer string? Compute Count(CGCGATACGTTACATACATGATAGACCGCGCGCGATCATATCGCGATTATC, CGCG). Extra Credit: Can you propose pseudo code to accomplish this? B. Define what a k-mer is. What is the most frequent 3-mer of TAAACGTGAGAGAAACGTGCTGATTA...
5 answers
2 Suppose H (x) = VSx" -4_ Find two functions f and g such that (fog) (x) = H (x)Neither function can be the identity function. (There may be more than one correct answer)
2 Suppose H (x) = VSx" -4_ Find two functions f and g such that (fog) (x) = H (x) Neither function can be the identity function. (There may be more than one correct answer)...
5 answers
Develop the esumated regression equation for these data .Use the estimated regression equation predict the value of When * = 20,
Develop the esumated regression equation for these data . Use the estimated regression equation predict the value of When * = 20,...
5 answers
Problem 8 PREVIEW ONLY ANSWERS NOT RECORDEDdly (2 points Find for d12y = 51' + 31dy dr?Entered Answer Preview
Problem 8 PREVIEW ONLY ANSWERS NOT RECORDED dly (2 points Find for d12 y = 51' + 31 dy dr? Entered Answer Preview...
5 answers
Uniform beam of weight SO0 N and length 0 m is suspended horizontally; a8 shown below: On the left it hinged wall; on the right it supported by cable bolted the wallWhat is the torque produced by the beam about the hinge?Cable2.8m430Beam5S00 NmB) -1500 Vm~ZS0 NmQuestion 8 (3 points)Using the scenario in Question What the Tension in tke cable?OA I= 366NB) T=422NT=SOON
uniform beam of weight SO0 N and length 0 m is suspended horizontally; a8 shown below: On the left it hinged wall; on the right it supported by cable bolted the wall What is the torque produced by the beam about the hinge? Cable 2.8m 430 Beam 5S00 Nm B) -1500 Vm ~ZS0 Nm Question 8 (3 points) Using t...

-- 0.018131--