5

In the acetylene torch, acetylenegas (C2H2)(C2H2) burns in oxygen to produce carbondioxide, water, and energy:2C2H2(g)+5O2(g)⟶Δ4CO2(g)+2H2O(g). How many mo...

Question

In the acetylene torch, acetylenegas (C2H2)(C2H2) burns in oxygen to produce carbondioxide, water, and energy:2C2H2(g)+5O2(g)⟶Δ4CO2(g)+2H2O(g). How many moles of CO2 areproduced when 3.1 mol of C2H2 react? How many moles of C2H2 arerequired to produce 0.47 mol of H2O?

In the acetylene torch, acetylene gas (C2H2)(C2H2) burns in oxygen to produce carbon dioxide, water, and energy: 2C2H2(g)+5O2(g)⟶Δ4CO2(g)+2H2O(g). How many moles of CO2 are produced when 3.1 mol of C2H2 react? How many moles of C2H2 are required to produce 0.47 mol of H2O?



Answers

How many moles of water vapor are produced for every mole of methane consumed in the combustion reaction $\mathrm{CH}_{4}(g)+2 \mathrm{O}_{2}(g) \rightarrow \mathrm{CO}_{2}(g)+2 \mathrm{H}_{2} \mathrm{O}(g) ?$

First thing you have to do in this question is to consider the formula. So the equation the chemical formula ever seen here is C three H eight plus five oxygen, um, then reacts to farm three co two plus for each toe up. So this equation is balanced. We had to look, look around and figure out ways in which, um, for example, the hydrogen is re balance. There's eight hydrogen here, Rita multiply by four. But then the oxygen's are also not balance. We have multiplied by three and one side and five on the other as well as the carpenter. And so was everything is balanced. We can now move forward. Now that we know the different ratios really use the number off leaders of C three h h have to convert that the leaders of C E O. To so for every, um one c three h eight, we have to multiply it by three leaders of co two with one leader of C three h g at the bottom so that these cancel and CO. Two is now your unit. We got this three from up here in the question. So there's only one here in their three here, so we just do 2.33 times three, which gives you 6.99 Leaders of co two Great. It's now. It's only one more thing we have to change before you can plug into our equation. We have to change. Temperature were just given in Celsius to Kelvin. So we have to take the 24 Celsius and add 273 to convert into Calvin. So 24 plus 2 73 is 297. Finally, what we have to think about. What are we interested in this case? We want to know the moles we want to know. So we have to take PV equals energy. Divide both sides by r t to leave and by itself and we get an equals p V divided by party. Now we just have to plug in. You already given the, um, the pressure, which is 67 point you keep e eight we calculated leaders above, which is 6.99 leaders. We're gonna divide those two by the rate, which we just know is 8.314 which, um and the rate is multiplied by the temperature, which were the couple that had 297 covers. So we multiply these two together and these two together and divide that new waiter by the denominator. And after we do that simple math, we get a 0.19 Most Theo, too. Um, it's important to notice here that we have leaders here in the bottom which cancels leader in the top. Keep your canceled. Which is how we get, um, the moles. So we have 1.90 moles Theo, too.

In this question We need to calculate the number of malls that will react with 2.50 moles of oxygen. And we also then need to calculate the number of moles that of carbon dioxide that will form in this case right before we do that by using mole ratios. We have to check if the version is balanced or not. It's not balanced because on the left hand side we have three carbons and on the right hand side only one, we need to have three carbons on the right hand side. If we check the hydrogen atoms now we have eight on left hand side and only two on the right hand side. So we need to put a four year in front of the water. And then in order to balance the oxygen atoms, We have 10 on the right hand side, six from the co, two and 4 from the water. So that gives us 10. We need to have 10 on the left hand side as well but we have di atomic oxygen here. So we need to have five of those molecules. So now the reaction is balanced. The equation is balanced and we can go ahead to use our mole ratios. So first of all I'm going to calculate the number of miles of propane gas. Um put that as the numerator and then as the denominator I'm going to use the known value which is the number of moles of oxygen gas and that needs to be equal 21 Over five. So the number of moles of propane gas will be equal to 1/5 times the number of malls off oxygen gas which is given as 2.50 moles. So this is an easy calculation gives us 0.50 falls in the second part of the question, I need to calculate the number of moles of carbon dioxide that's being produced. So here the number of carbon dioxide molecules or the the number of moles of carbon dioxide is the numerator. Do you nominate is still the number of moles of oxygen that's being provided and that needs to be 3/5 because the story geometric coefficient of Carbon dioxide is three And that of oxygen is five in our balanced equation. So now I can see that the number of moles off carbon dioxide is equal to 3/5 times the number of moles off oxygen, which is given us 2.50. And then I end up with a value of one .5 moles of CO. Two. So here I had to balance the equation first before I could use more ratios in order to calculate the unknown moral values.

All right, So we're going to use multi more issues to solve for, uh, the stork, Yo. Metric questions. So first thing you need to do is go ahead and read through your question. This first question, I just forgot to put it, but it should say completely. Racks with two point zero moles of die carbon die hydrate. Okay, so this is our given are unknown, is how many moles of 02 So I'm gonna put a question mark with the units above 02 and above die carbon dehydrate. I'm gonna put the 2.0 moles underneath. I'm gonna look at my coefficient, and I'm gonna copy that co fishing down, and then I'm gonna put the unit moles. So this is accounting number in this balanced equation, but we know that we can associate this coefficient with the number of moles of each caught a compound. So now that we have put our information on top from the question and we've brought down the information down the balanced equation on the bottom with the units we check our units. If the units match were good somo symbols and then moles, moles, those air. Good. So Now, this is a simple for a portion problem. So I have to 0.0 moles divided by 2.0 moles. That is going to be equal to an unknown number of moles of oxygen divided by five moles of oxygen. So everyone reaction I do. This coefficient is how many of each compound I'm gonna use up. Queen. So this is my conversion factor on the bottom. So two divided by two is one question mark divided by five. I have no idea. So we need a multiply five on both sides. Cancels on this side one times five is five. So I have. So I'm gonna need five moles of carbon die high drug in order. Excuse me. I need five moles of oxygen in order to make to use up two moles of die carbon 100. Okay, we're gonna do the same thing with the next question. Okay? We have an unknown number of carbon dioxide. We have 3.5 moles of die Carbondale hydride noticed. Two sig figs came, so I'm gonna fill up the information on the top here, so I don't know how many carbon dioxides and you know I want to know the number. Moles. I have 3.5 walls of die carbon die hydride Four moles of carbon dioxide, Two moles of carbon That hydride. So now I said I'm a proportion my units match so I don't You change anything were converted using. So there's an unknown number of moles of carbon dioxide over four moles for every time I do the reaction. So 3.5 divided by two is 1.75 equals are known to buy by four were multiply four on both sides. So there are gonna be seven moles of carbon dioxide created for every 3.5 moles of die carbon dot hydride that I have, um, going back to Sig Figs. We have 3.5, so this is actually gonna be 7.0 so that my signature significant figures are correct. Now, notice the numbers that come out of balanced equation or only one number. So why is our answer not 16 big? Any time that we're talking about the number of compounds from a reaction, Um, those numbers are counting numbers, so they're not significant. We only count things that we measure out significant so I could convert moles 3.5 moles to grams and measure out that number of grams. Okay, going to the next question how maney rules of die carbon die hydride or needed to make 0.5 moles of water. So I'm gonna fill out my given information on top. So I don't know how many die Carbon Dahan dried somebody beautiful that in being on the bottom, I put the number of, um, compounds that are gonna be used up in one reaction. So notice two miles and two moles on the bottom there, the same coefficient. So my answer or my numbers on top. So I mean, there's the same units should also be the same. So my answer should be half of a mole. But we're going to do the math just so you can see it. And it's very important that your units match top and bottom. If they don't, you're gonna have to convert a 0.5 Divided by two is 0.25 We don't know what question Mark divided by choose, but we can multiply both sides by two canceled on this side. What, 25 times two equals 0.50 moles of C two h two, which is what we predicted so again to Sig Figs. So my answers and two significant figures remember leaving zero's air never significant. That's why that 1st 0 doesn't count. Okay, Last question. How many moles of carbon dioxide are made of 0.1? Moles of oxygen are made. So we no 0.100 change colors. You know that this is our given my units. They're five moles of oxygen for everyone Reaction. You know, I want to know how many moles will see what you mean to make you know, For everyone reaction, there's gonna be four moles. So now I just set up my proportion. Okay. Okay. So 0.1 divided by five is 0.2 And we do not know what question Mark divided by four is. But we can multiply both sides times for to get the question mark by itself. And that gives us 0.8 and we have three significant figures. So I need to add two zeros onto here in my units for moles of carbon dioxide. So that's how we use more more ratios to solve these Struck you midget problems

In this question, we need to calculate the number of moles of each one of the reactant when the number of moles of water is provided. Now, before we can do that, by using the mole ratios, we know that we should check if the reaction equation is balanced or not. This one is not balanced. We have four carbons on the left hand side and one on the right hand side. So let's start off by trying to balance the number of carbon atoms, Putting a four year in front of the co. II, Then we have 10 hydrogen is on the left hand side and only two on the right hand side. Now, if I put it five in front of the water, this will cause an uneven number of oxygen atoms on the right hand side and on the left hand side we have di atomic oxygen, which means there will always be an even number of oxygen atoms on the left hand side. So therefore we need to work with an even number of oxygen atoms um for water And I'm gonna try 10. But if I do 10, This gives me 20 hydrogen on the um right hand side. So I have to put a two year in front of the butane gas. And this then affects the number of carbon atoms, which is then eight. So I have to have Um 8 CO2 on the right hand side. Now to check the number of oxygen atoms on the right hand side, We have 16 in CO2, and we have 10 in water. That's 26. So I can just put a 13 here in front of the oxygen gas and then the equation is balanced. Right now, I can use the number of more or the mole ratios in order to do the calculations. So the number of moles of butane gas C4 h 10 over the number of moles of the known substance, which is water um is going to be equal to Um story geometric coefficient of Putin gases too. So that's two over the short story geometric coefficient of water is 10. So now I have the number of moles of butane gas is equal to 2/10, which is 1/5 times the number of moles of water, which is Given us 2.5. Right, And that's simple um calculation that gives us a value of 0.50 moles. Next up, we need to calculate the number of moles of oxygen. Alright, oxygen gas over, once again as a denominator, I'm going to use the number of moles of water. And if I check my balanced equation, I see that I need to use a ratio of 13/10, 13, 13. So My number of moles of oxygen will be 13/10 Times the number of moles off water, which is given us 2.50. And then When I calculate this, I get a value of 3.25 moles for the oxygen. All right, so let's just check quickly. I had to balance my equation first before I could use more ratios in order to determine the unknown number of moles of both reacting to butane gas, and also for the oxygen.


Similar Solved Questions

5 answers
Determine the directions where the derivative of2f(x,y) = xy + y2 at the point _ P(3,2) is equal to zero.
Determine the directions where the derivative of 2 f(x,y) = xy + y2 at the point _ P(3,2) is equal to zero....
5 answers
16. In a random sample of 2,300 mortgages taken out in certain region ast year; 187 were adjustable-rate mortgages_Give point estimate of the proportion of all mortgages taken out in this region last year that were adjustable-rate mortgages:b. Assuming that the sample is sufficiently large construct 99.9% confidence interval for the proportion of all mortgages taken out in this region last year that were adjustable-rate mortgages_
16. In a random sample of 2,300 mortgages taken out in certain region ast year; 187 were adjustable-rate mortgages_ Give point estimate of the proportion of all mortgages taken out in this region last year that were adjustable-rate mortgages: b. Assuming that the sample is sufficiently large constr...
5 answers
~pelsSCelczT8 16.4.011_Use Green'$ Theorem to evaluate(Check the orientation of the Curve before applying the theorem )F(x, Y) = (y cos(x) Xy sin(x) *ycos(x)) _ C Is the triangle from (0, 0) to (0, 6) to (3, 0) to (0, 0)
~pelsSCelczT8 16.4.011_ Use Green'$ Theorem to evaluate (Check the orientation of the Curve before applying the theorem ) F(x, Y) = (y cos(x) Xy sin(x) *y cos(x)) _ C Is the triangle from (0, 0) to (0, 6) to (3, 0) to (0, 0)...
5 answers
ChCtbDH Iili Ph Draw all products [uclodins Skxeoisdmeks tut will fbRm In ths Keuhibn.
chCtbDH Iili Ph Draw all products [uclodins Skxeoisdmeks tut will fbRm In ths Keuhibn....
5 answers
~/1 pointsHarMathAP12 11.4.021.My NotesAsk Your TeacherSuppose that for particular product, the number of units produced per month depends on the number thousands of dollars invested, with production increase S10,000 invested and the investment capital increasing rate si000 Per month?_ nits {month?40y S0y2_ At what rate villNeed Help?nn=SetheFnnetSubmit AnswerPractice Another Vorsion1/1 points Previous AnswersHarMathAP1Z 11.4.033.My NotesAsk Your Teacher
~/1 points HarMathAP12 11.4.021. My Notes Ask Your Teacher Suppose that for particular product, the number of units produced per month depends on the number thousands of dollars invested, with production increase S10,000 invested and the investment capital increasing rate si000 Per month?_ nits {mon...
5 answers
4,3,17 Find lhe Cfen iterudlson tkn Boto #otnredihnrodergind Itatuqon [ adeteYalx (atn Entietstdeeroo OotCnau"a QuerttrIeeadLrenurnr
4,3,17 Find lhe Cfen iterudlson tkn Boto #otnredihnrodergind Itatuqon [ adeteYalx (atn Entietstdeeroo Oot Cnau "a Querttr Ieead Lrenurnr...
5 answers
Of the following 15-bp double-stranded DNA sequences, which will be most stable at higher temperatures? In other words, which will most likely remain in a double- stranded form? (Note: only 3 single strand of DNA is shown)CATCCTAGCGACTATATCTGATTCTGACCGATCGCATCTCTGGCTATACGACATAGCC
Of the following 15-bp double-stranded DNA sequences, which will be most stable at higher temperatures? In other words, which will most likely remain in a double- stranded form? (Note: only 3 single strand of DNA is shown) CATCCTAGCGACTAT ATCTGATTCTGACC GATCGCATCTCTGG CTATACGACATAGCC...
5 answers
(15 points) 7 . Use the Gram-Schmidt algorithm to find an orthonormal basis for the nullspaceof A0 1 -
(15 points) 7 . Use the Gram-Schmidt algorithm to find an orthonormal basis for the nullspace of A 0 1 -...
5 answers
There is a squirrel scurrying along straight path such that the velocity of the squirrel, U S f where velocity is measured in centimeters per second. Find the average acceleration of the squirrel on the interval [5, 12]. Indicate units of measureI f (r f' (x)25101222222
There is a squirrel scurrying along straight path such that the velocity of the squirrel, U S f where velocity is measured in centimeters per second. Find the average acceleration of the squirrel on the interval [5, 12]. Indicate units of measure I f (r f' (x) 2 5 10 12 2 2 22 2...
5 answers
Consider the following reactions: P 4 (5) +6ci 2 (g) Apci apci 3 (3) 5 (g) P4 (s) + 1oci 2 (B)Ah , 2439 Ki AH 2 " 3438 k}What Is AH for the following reaction? PCI stg) ~~PCI 3g) +CI 2lg)
Consider the following reactions: P 4 (5) +6ci 2 (g) Apci apci 3 (3) 5 (g) P4 (s) + 1oci 2 (B) Ah , 2439 Ki AH 2 " 3438 k} What Is AH for the following reaction? PCI stg) ~~PCI 3g) +CI 2lg)...
5 answers
Use @ skotch to Tind Ine axact valuc of tFe fo omro OxEress [" " '(3)] Whict 0l te IcIloung tnangity correz1I0 wtde Iho Gyen 0 piegs ?Hohmic tpM-reio"(H-=Wse mezeia %r #acuonts (oc ahy nurorn W 0
Use @ skotch to Tind Ine axact valuc of tFe fo omro OxEress [" " '(3)] Whict 0l te IcIloung tnangity correz1I0 wtde Iho Gyen 0 piegs ? Hohmic tpM-reio "(H-= Wse mezeia %r #acuonts (oc ahy nurorn W 0...
1 answers
C(s) Given the transfer functions G(s) R(s) 5 + 2Calculate the time domain C(t} with input r(t) 27 (8 Marks) 2-Calculate the system gain of the system and the steady state value? (6 Marks) 3 Calculate time constant Tc rise time Tr and Ts? (6 Marks)
C(s) Given the transfer functions G(s) R(s) 5 + 2 Calculate the time domain C(t} with input r(t) 27 (8 Marks) 2-Calculate the system gain of the system and the steady state value? (6 Marks) 3 Calculate time constant Tc rise time Tr and Ts? (6 Marks)...
5 answers
Frblem 42 tcs uitl That B= C -] cpmm Suppa A Ik lite _ A DisreUe haL iMu Ia trix
Frblem 42 tcs uitl That B= C -] cpmm Suppa A Ik lite _ A DisreUe haL iMu Ia trix...
5 answers
(Zpls) Give an example of an infinile ajuanbas which converges bul whose sum diverges.
(Zpls) Give an example of an infinile ajuanbas which converges bul whose sum diverges....
5 answers
Prove Re (Ra (x,y)) Ra+B (x,y) using trigonometric Identities to simplify the given product to rotation form: Eosle) kinfa) cosie) sin(e) Rate(x,y)sin(o)Icos(a)~in(e)cos(B}
Prove Re (Ra (x,y)) Ra+B (x,y) using trigonometric Identities to simplify the given product to rotation form: Eosle) kinfa) cosie) sin(e) Rate(x,y) sin(o) Icos(a) ~in(e) cos(B}...
5 answers
Which MO is the LUMO of CNSelect one:a: 2npb Zop*C 2os*d. 2op*e. Ztrp*
Which MO is the LUMO of CN Select one: a: 2np b Zop* C 2os* d. 2op* e. Ztrp*...

-- 0.021839--