5

The 20.0 cm $ imes$ 35.0 cm rectangular circuit shown in $ extbf{Fig. E27.41}$ is hinged along side $ab$. It carries a clockwise 5.00-A current and is located in a ...

Question

The 20.0 cm $ imes$ 35.0 cm rectangular circuit shown in $ extbf{Fig. E27.41}$ is hinged along side $ab$. It carries a clockwise 5.00-A current and is located in a uniform 1.20-T magnetic field oriented perpendicular to two of its sides, as shown. (a) Draw a clear diagram showing the direction of the force that the magnetic field exerts on each segment of the circuit ($ab$, $bc$, etc.). (b) Of the four forces you drew in part (a), decide which ones exert a torque about the hinge $ab$. Then calcu

The 20.0 cm $\times$ 35.0 cm rectangular circuit shown in $\textbf{Fig. E27.41}$ is hinged along side $ab$. It carries a clockwise 5.00-A current and is located in a uniform 1.20-T magnetic field oriented perpendicular to two of its sides, as shown. (a) Draw a clear diagram showing the direction of the force that the magnetic field exerts on each segment of the circuit ($ab$, $bc$, etc.). (b) Of the four forces you drew in part (a), decide which ones exert a torque about the hinge $ab$. Then calculate only those forces that exert this torque. (c) Use your results from part (b) to calculate the torque that the magnetic field exerts on the circuit about the hinge axis $ab$.



Answers

The 20.0 cm $\times$ 35.0 cm rectangular circuit shown in $\textbf{Fig. E27.41}$ is hinged along side $ab$. It carries a clockwise 5.00-A current and is located in a uniform 1.20-T magnetic field oriented perpendicular to two of its sides, as shown. (a) Draw a clear diagram showing the direction of the force that the magnetic field exerts on each segment of the circuit ($ab$, $bc$, etc.). (b) Of the four forces you drew in part (a), decide which ones exert a torque about the hinge $ab$. Then calculate only those forces that exert this torque. (c) Use your results from part (b) to calculate the torque that the magnetic field exerts on the circuit about the hinge axis $ab$.

This's Chapter twenty seven. Problem number forty two. We have a closed loop there, tangled Lubo. Wider. This is the direction of the current. It's imbedded in an external magnetic field that is going to the page here. We know the magnitude of grooming that it feels wrong. Tesler. We know the length off this rectangle. It's thirty five centimeters. With his twenty two centimeters, we now know the current passing through the slope of wire, one point nine five camps now impart A. We are asked to calculate the Net force acting on this opposable wire in order to to your debt out. Let's break the force into segments, though let's say for this side is the same one from here to there, never getting a divorce. That's coldest signal two, three and four. Now we look at the direction of the force for the first segment when you use a different problem. As you know, from the right hand roll, your funk is along the direction of the current, which is down and be. The rest of your fingers are aligned with B into the page, so curl your fingers ninety degrees. You're going to see that this force that's called it. That's the one in magnitude it's going to be equal to ay well, the length, the current times, the length about this wire, which is and w right kind's thie, the language tube magnetic field times sine of the angle between I and B, which is ninety. So I'm dropping that. So the force exerted on Segment one is I W B. Now let's go across to sing them three real quick. Let's get that out of the way. This's the direction of the current high. If you use the right hand rolled ball again, we're going to see that, Let's say, three. He's actually along the opposite direction of F one. However magnitude advised their equal to each other. So when? Well, let's do. Let's try and calculate the magnitude of the force exerted on segment too out again. This is the direction of the current you feel liner thumb with directional, the burnt in rest of the fingers along the direction will be curl your fingers nine degrees. You're going to see that path too, is actually up, and the magnitude would be I l this time little l we called it this guy I l times the fee and sign of the angle between I can be. As you know, it's nine days from drafting the sign terms when we go to segment forth, then after four is going to be down. But again, I l v is going to be the magnitude. So is it you see, when we calculating the net, we're basically on minus if, uh, three along extraction. It's full this X. If my sister is going to give you zero and if Mexico long wire direction, by the way, I'm using this convention. This is why positive? Why negative? Why Positive X and Meghan effects. So then along why direction is going to be equal to F to minus at court, which is a zero again right here off World Force Acting on the stoop has to be with zero. Now when he comes torque Simms. Well, let's let's remember the equation for Tor High times. He turns a times sign on the door between hey and be right. So in this case, the direction of A is actually out of the board towards us. This is the erection of a direction of bee is, as you know, into the board. So the angle between the two paydays basically hundred. Maybe Greece and sign of one hundred and eighty tested you zero making the entire port here. So this is the answer to part A In party, this portion is a little tiny, bit more complicated. Now there is the the loop is rotated thirty Greece around an axis around the access access being Okay, this is the loot. The access through this is vertical axes. So from the tough you actually what's going on if we look at it from here, is that this is the initial position off the loop, right? So then you're tilting kind of tough view. We're tilting hour. Look, thirty degrees with respect. Tio horizontal. So this tangled is going to be eternally be Greece. What is that going to change? Um, we're going to see. So actually, force wise, I meant it's not going to change anything. Still, your they have to have met force equal to zero, because off the same reason is, as we discussed in part A. This is if this is F Juan and this is going to be F three again, they're the same in magnitude. so definite overall has to be equal to zero in on part B. Now, as faras, the torque is concerned. Now we actually have something else right again. Let's remember the equation for pork i b times. A tense time finger Now from the top you. I think it's easier to understand again, really connected direction of normal off the area and with respect to the direction off the magnetic field from the top. For you, direction of the magnetic field would be fucked. Correct. He would look something like this. This is the direction of the magnetic field. Now the direction of the area vector would be something like this. So what is the angle between the two? Gloriously, this disputation is thirty degrees, which means the angle here is thirty acres, which makes the angle between the tool one hundred eighty minus thirty Greece, which is one hundred and fifty degrees. Right? So then how are we faring? This case is a hundred and fifty degrees, and while the rest is pretty much the same right, the current was given to us his one point nine and piers and the magnitude of immigrant fielders one point five Time's area being in their area of a rectangle that's going to be way times with. So then I was thirty five. Ten, ten to the negative. Two meters, right? We did have the immersion going. Two attempts tactical Negative. This's the area. Oops, soldiers. And then, um, we have the sign one fifty. You figure the calculation Berkeley will get this point one one? Oh, yeah, Meters for torque. Now it's time to determine direction. Our going to determine the direction of talk again. It's their right hand, right? So we're gonna align our film with direction of the area along the direction of the area, and the rest of our fingers are going to be showing the direction of the Byfield. And then we're gonna curl our fingers ninety degrees from the top few. Then it's actually going to be towards us direction of the torque. So let's say the direction of torque is going up the Lexus right? So he's so something or kiss. If this is the direction of the torque, then what can we say about the direction of rotation? Because they're too. They're from things, right? Direction, hold mortician, then using again right hand roll, it's gonna have to be from the top U. It's gonna have to be camera, right? Yeah,

This's Chapter twenty seven. Problem worth sixty eight. We have a circular loop. You It'd about about the y axis. Um, I'm going to draw the problem from the top U. So this would be our positive, my direction. And then we would have sex Here and again, the circuit is pivoting about the Y axis. So that say, this is the one side of the group in the current flowing for that side. Fifteen cents beginning. This is from the talk for you. You should be in positive Z access than so this single is given to us A thirty Greece and now, in part, saying we're trying to find the magnitude infraction of the torque toe hold the loop in its place just like this. Which means we need to calculate did torque applied by the the magnetic field. And then we're going to see the net. Talk has to be zero. So along the up destruction we're going to pick our talk to be toe hold this in place. So in part, a direction the bi fuel is given to us is positive extraction. So the magnetic field here's a long positive extraction. So let's determine the direction of the magnetic a moment. So if the current is going this way the magnetic moment let's remember new new clues. Pry A from the right and rule. We're going to determine the direction of Mu to be this. So if you look at the angle between the two, this angle would be thirty. Because these two lines of parallel then the angle between near and be here is sixty degrees. Sonia calculating twerk me Crosby off course. But I'm writing them magnitude. You'd be sine of the angle between you two. New being items. A. So let's substitute here by a bee sign data that is pretty intense. Area is Final six again. Pete, I'm writing this in terms of meters going leaders Time's going for tests. Look, I'm signed sixty degrees. So whoever plug everything in, what we find this plane going? Three new premieres for torque. So this is the moment you left will get the direction now direction. All this torque can be found flying right hand roll. Right. So from the right hand rule, if we align our thumb with the direction of meal and the rest of the fingers with friction of the Byfield. When you curl our fingers ninety degrees, we get the direction of the torque. In this case, the direction of the torque is going to be into the page into Paige being negative. Why? Direction said, in a missed work, he's going to be, uh, along negative j direction, right of ever. We want the direction, all the torque that holds this loop in its place so that the network has to be equal to zero. Then to talk that we need is the same magnitude, same magnitude of torque to hold it in place, but a flying along the opposite direction. So what we're looking for is a torque that has this magnitude that applied along positive j have direction. Thank you, sir. So in part B, what we have is what happens if the no magnetic field is along negative z direction, then what would change instead of having to be a long positive extraction? So this is negative Z direction, right? So if our b thiss time goes up like this instead of going along negative extraction than the angle between you and be his, you can see uh, this is sixty degrees. So this portion is going to be. How thirty degrees again. What will be the torque? They will be here. Be sign Zeta Mu Bean. I can't the science data. So the car was fifteen temps areas, six meters. Grant's point eight liters Mignon grilled for eight. Tessa. Now, this time we have something fell thirty. So I'm applying everything in. What we find is flight for seven meter. Let's look at direction again using the right general, our thumb is aligned with the direction of me Rest of the fingers, There, along the direction of B. When we crawl our fingers ninety degrees. What we see is this torch is along actually positive J had direction. So to balance it out, then we have to have the same magnitude of port. No, but along Negative j had direction. Then we would be holding that in its place. No part see is asking what will change where answers to our A and B change if the luke who was pivoting through an access that that passes through the center off him. So you remember Marie, this is positive. Wife. This is how I'm sorry. This is excessive. We have, uh, Luke that can rotate around the central point. So look, the ah, the There will be a torque on both sides so way would have to consider the tour from this side and decide if the people if the period point is between these two points, there will be, Let's write it down. There would be torque on both sides off Luke, but so the force would be doubling, but the deliver the level arm like instead of having to Al Now we have over two, right? This is from here to there. But the level arm would be have so that the total torque would not change. What? So the answer's two part A of me briefly had the rotation around the middle point off the Luke. Actually, our answers to fight handy would not change.

So for the first park they're going to use force. Disagreed Toe I times the cross product ofthe land on magnetic food on the skip's the magnetar Tow the high times L A. Times B signed 55 dangle between land on the magnetic field on direction is given by by tender, so we're going to apply this a question. Don't eat segment and see what we get, so f b Q. It's gonna be i times l thank you. The current is basically capital I, who directs right capital light image after case times being sci fi so fi for pick your segment. You say that I envy a parallel suffice zero degree and then skips the force to be zero on the segment for segment be art. We do the same thing I think you are times the magnetic field time science still here they're for particular. So this is 90 degree This gifts high times and the yard times the magnetic field on and off We get this valued tto be two hours No turn on my right and rule. The direction is gone away into the screen or into the cage. Similarly, we do the same thing for q R. It is I, uh q aj green things sign. Sy, this is quite a toe. I times. So, Elke, what is basically best this distance which can be found from fighting with those theater? Because this is basically 90 degree still no and cure. Then we could do scheduled off the sun off the scares off the two sides times b times, sine fi. So if this is fly, this is gonna be 90 minus five. So this is basically 99 a spy, sir, this is five. That's what we have. So Okay, let's check it. And so this is basically 52 this is 1 80 minus five. This is 1 80 minus five. So this will give this angle to be fine. Okay. So if this angle is fi, then sign Fei is going to be the, um, perpendicular for the hyper tennis. So that will be and thank you. Who won get dissed imminent. Wass Ok, I think Felicity checked this value of fragging. So this is not the angle between I ended. I envy. This is strangled. So if this is tangled than this is whose this is the fire that we need. So that is equal to L b e r over and keep watch. So on just right that then be art. We'll lodge and Q r and cue is basically this value. So let's do this. This is come goingto come One meter said this will be 0.8 over one with them and we find the force to be 12 new done in this case. But the direction is gonna be How does the beach? You don't need to find a cure. Actually, Explicitly. Because these just cancel out ultimately. So, yeah, now the Net force. Okay, I distraught f ear in being here instead. Off said, the net Force is Victor some off all of his forces. And you see that we have drilling down into Page Blaster Lincoln out off the pits. This they just canceled. So the net force is goingto be Cedo. So this is the second part? No, for the third. But for calculating talk on the street wire, we can assume that the force on a wire is applied at the lyre sustains Andi also know that we're finding the talk with respect. Oh, the PR axis. It is this access. I'm not about the point on. Consequently, the lever arm will be their distance from the wires send up to the exact sis. So excuse that's a carcass equal to ours. Grass f. And so the magnitude ofthe dog will be our times. F times signed five on DH. We apply this to segment, so I think you will be our times after just basically zero f thank you from here. So target is going to be single here. Similarly odd start PR being quinto all times f b r signed by, but here are physical does zero because the accesses now, because this is taxes about which we are they finding the dog. So this is Seattle on so doctor's office, a contra CT and floor dark about the segment. Kilowatt, we have AJ So why am I doing the tilapia supply times f Qula dimes, sci fi. So our is basically the center ofthe this from the access beyond axis. So that is going to be half off the distance off. Thank you. This is the second. So this is going on behalf of the lessons of freaky said that he called a 0.3 liter we found your Toby. 12 Note done on DH Sci fi. You see, this is out off the page and the force and our is basically on this plane on the paint off the page. So the angle between these two is going to be fine to decree on. So we don't get this right up to the point six New Bern Banks leader. And so the net dog is the Quinto Victor. Some off all these dogs, it's still 16 Newton. Thanks Mito on We can find the direction off the taught by right and rule being applied on r and F. Still, this is basically are on the forces out off the page. Satar is basically going to be two words, right? Hey, Now, for the last part, we use Starkey quando you grossly the muse and dines items is a dog magnitude off the dog will be and I a times the my trough magnetic cleared mine signed fi on DH fei is 90 degree Let's just write although values so and it's just one because it is just one. Dawn III is given to the five and feel everything that appeal. I had the area is the half off base off high base times height. So it is half Brian's land. Half thank you. Time sank off B I on DH Magnetic field is three dessler and sci fi sign fires. Physical 90 degree. So we use those values here And because the dog Toby 3.6 new 10 meter, which agrees with our result from party No, If you take the direction, you'll see that the direction off this we'll also be come that the direction can be choosed can be found using the applying the right handle on the moment on DH magnetic fields if you see that And if you applied over here, you'll see that the moment is out of the paper on dh. Sorry. The moment is into the paper on magnetic field is of the words upwards. So auf lang died handled so that we get and start your surgery. It's Nate. So both the magnitude and direction we recalculated here agrees with that potsie I'm for but he so we see that if you are is out off the page. And since this is the force that produces the neck dark, the point Q will be rotated about rotated out off the plane off the figure because the target is what sights, despite there is gonna be voted out off the plane off the figure.

Problem. 11.70 three's we have and just a B. And then there's been a cable attached point. See the point D that's then intentioned until there's no horizontal force. So we want to know what the tension in this case you want to know what the horizontal force it be is because you know it. Zero here in a but we're going to be there's going to be some it. Then we want to know what the total vertical forces combined from A and B. We can't find them separately with the information given where we can find their self. So the we used the as our origin about which we computer reports. Uh, both the X and Y components of the tension are going to be contributing because the line from B to hear is not a long one of the coordinate axes. And so neither one is parallel or anti. That's a little bit of a wrinkle. Um, you know, compared to what we usually see in these problems, But we can we could have. So this is times four meters bus signed, 30 degrees times two. That's because it has a moment. It's two meters in the horizontal one has a moment. It's four meters and the minus the weight of the gate, which has a moment of two meters as well. And so this has to equal zero. So we just solve this for the magnitude of attention. It's what you w over to sign to save ourselves. Writing college data 30 degrees plus no sign of data. Plug in the numbers, and this is 375 Newton's now find horizontal force. We again used the knot again, but we use now the force conditions for equilibrium. Horizontal forces have to some zero. And so the X component of the force of B by this tension zero and only the tension is providing any other horizontal forces in this problem. So the horizontal component of the force it be, is equal 325. Putin's now using this, except for why you know that. Hey, why plus the y And some of these two things are what we're finding because recall. I said, uh, you can't find them separately, but you can find their son. And the reason is because we don't have enough equations. Um oh, yes, plus the vertical component of attention minus the way is equal to zero. And then you just take the relevant things over for the right hand side. But the numbers in all of which we already know, and so the total vertical force, it's 512 minutes.


Similar Solved Questions

5 answers
Ce"=0_(4) (10 points) Write the equation for the tangent line to f(c)
ce" =0_ (4) (10 points) Write the equation for the tangent line to f(c)...
4 answers
RNA processing that does NOT target specific sequences is:polyadenylation: B capping: done to all pre-mRNA molecules C adenine methylation: D splicing: All of these target specific sequences_
RNA processing that does NOT target specific sequences is: polyadenylation: B capping: done to all pre-mRNA molecules C adenine methylation: D splicing: All of these target specific sequences_...
4 answers
Complete tne corplementary strand 0f DNA: 3' - ATGGATCTCGCAT5' ! TACCTACAGCGTA5' - TACCTACAGCGTCCATCTGTAGCGTA~ATGCGAGATCCATCTTCAGGCATCAT25pisQuestion 1116)} Consider the following double-stranded DNA region: AGCCGTCGTA - 3' 3' -TCGGCAGCAT - 5" If the lower strand is transcribed, which RNA strand will result?AGCCGUCGUA0 3 TGCCATCGCAAGCCGUGCUAAGCCGTCGTAUCCCCACCAU
Complete tne corplementary strand 0f DNA: 3' - ATGGATCTCGCAT 5' ! TACCTACAGCGTA 5' - TACCTACAGCGTC CATCTGTAGCGTA ~ATGCGAGATCCAT CTTCAGGCATCAT 25pis Question 11 16)} Consider the following double-stranded DNA region: AGCCGTCGTA - 3' 3' -TCGGCAGCAT - 5" If the lower stran...
5 answers
The per pupil-coststhousands of dollars) for cyber charter school tuition for southwcstem Pennsylvania? At a = 0,05,is there school districts in three areas FGm 6.78 diflerence in the means? (note: )ANOVAreaArea IIArea III7,008.125.231.3760.6382.659Compute S; and S7 Do not perform the hypothesis test !
The per pupil-costs thousands of dollars) for cyber charter school tuition for southwcstem Pennsylvania? At a = 0,05,is there school districts in three areas FGm 6.78 diflerence in the means? (note: )ANOVA rea Area II Area III 7,00 8.12 5.23 1.376 0.638 2.659 Compute S; and S7 Do not perform the hyp...
5 answers
(H9polngslDetnLs Snc7Kaii &eloorAiYcug T IchuaHurdont on ILstbonid [ Mtceruend ntnneAc7 Ahlh ne On FL Tncanh DIrt Lutroardc moina In tra dirdn d [ha nri totte unebotrdct Jolcctrd t0 ptntna Dron Healrboudort urunan Perdenorluetrnant'UlalestJerraAeeyour TEacrsr[-n Potnt]DEAILSSerceihait 14wa0z6Ledon 6dom L5a
(H9polngsl DetnLs Snc7Kaii &eloor AiYcug T Ichua Hurdont on ILstbonid [ Mtceruend ntnneAc7 Ahlh ne On FL Tncanh DIrt Lutroardc moina In tra dirdn d [ha nri totte unebotrdct Jolcctrd t0 ptntna Dron Healrboudort urunan Perdenorl uetrnant' Ulalest Jerra Aeeyour TEacrsr [-n Potnt] DEAILS Sercei...
5 answers
V"pJuONgv*q8 'eaiowz-8 aow L=V 9V ~ 9 + V :uoinjeau BuJmoIlo} U! JuenjeaJ Bupull aq IIIM 42I4M6 NOILS3nO
V"p JuON gv*q 8 'e aiowz-8 aow L=V 9V ~ 9 + V :uoinjeau BuJmoIlo} U! JuenjeaJ Bupull aq IIIM 42I4M 6 NOILS3nO...
4 answers
False Tna IV V range true from 1 19 3 hypothesls lesling
False Tna IV V range true from 1 19 3 hypothesls lesling...
5 answers
Find the vertex and transformations:y=r_2r+5y=2-3) _ 2
Find the vertex and transformations: y=r_2r+5 y=2-3) _ 2...
1 answers
Determine any point(s) of intersection algebraically. Then verify your result numerically by creating a table of values for each function. $$\begin{aligned} &4 x-y=4\\ &x-4 y=1 \end{aligned}$$
Determine any point(s) of intersection algebraically. Then verify your result numerically by creating a table of values for each function. $$\begin{aligned} &4 x-y=4\\ &x-4 y=1 \end{aligned}$$...
5 answers
Find the orhogonal trajectories of the family ofcurves given by y = Cx}
Find the orhogonal trajectories of the family ofcurves given by y = Cx}...
1 answers
Multiply the numbers, using the method found on page $40 .$ $$\begin{array}{r} 50,000 \\ \times \quad 6000 \\ \hline \end{array}$$
Multiply the numbers, using the method found on page $40 .$ $$\begin{array}{r} 50,000 \\ \times \quad 6000 \\ \hline \end{array}$$...
5 answers
(Figure 1) shows a 18-cm-diameter loop in three different magnetic fields. The loop's resistance is 0.90 92For the steps and strategies involved in solving a similar problem, you may view a Video Tutor Solution:Figure1 of 1(a) B increasing 4t 0.50 Tls(b) B decreasing 4 050 Tls(c) B decreasing at 0.50 TlsX Kax XX *X X x *X XX X x XX XUx *
(Figure 1) shows a 18-cm-diameter loop in three different magnetic fields. The loop's resistance is 0.90 92 For the steps and strategies involved in solving a similar problem, you may view a Video Tutor Solution: Figure 1 of 1 (a) B increasing 4t 0.50 Tls (b) B decreasing 4 050 Tls (c) B decrea...
5 answers
12. [2/4 Points]DETAILSPREVIOUS ANSWERSSlALLOMY NOTESPRACTICE ANOTHERA table of values for 6, 9, f and g' is given-f(x)g(x)"(x)9 (x)(a) If h(x) f(g(x)) , find h'(1). h"(1)(b) If H(x) =.g(f(x)), find H"(1). H(1) Enter number Need Help? Antau MhbhlSubmit Answer Viewing Saved Work Revert to Last Response
12. [2/4 Points] DETAILS PREVIOUS ANSWERS SlALLO MY NOTES PRACTICE ANOTHER A table of values for 6, 9, f and g' is given- f(x) g(x) "(x) 9 (x) (a) If h(x) f(g(x)) , find h'(1). h"(1) (b) If H(x) =.g(f(x)), find H"(1). H(1) Enter number Need Help? Antau Mhbhl Submit Answer Vi...
5 answers
Select ~Using IW 825 62 b3 one: Athe and MO xoq reference label diagram beorayoo LU energy tor the drawn of S: for moleculae "0001 the klmol; ion SN bond ionization You order will for asn the energy this NS 2 ion is: this 1402 and klmol) the next question; and submit 1
Select ~Using IW 825 62 b3 one: Athe and MO xoq reference label diagram beorayoo LU energy tor the drawn of S: for moleculae "0001 the klmol; ion SN bond ionization You order will for asn the energy this NS 2 ion is: this 1402 and klmol) the next question; and submit 1...
5 answers
5.17 922A1 2.39 284 (3+h)-1_371 lim 4 Hea 9 4#0 [email protected] J 38 7aq2
5.17 922A1 2.39 284 (3+h)-1_371 lim 4 Hea 9 4#0 [email protected] J 38 7aq2...
5 answers
(6 points} Use polur coorclinates to find the volume of the #olid which Ander the prabloid 3" ntd ahove the disk r" V$4
(6 points} Use polur coorclinates to find the volume of the #olid which Ander the prabloid 3" ntd ahove the disk r" V$4...

-- 0.021515--