5

A double-stranded DNA molecule with the sequence shown produces, in vivo, & polypeptide that is five amino acids long: TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACT...

Question

A double-stranded DNA molecule with the sequence shown produces, in vivo, & polypeptide that is five amino acids long: TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACATWhich strand of DNA is the template strand, and in which direction is it transcribed?first strand; left to right second strand; right to left first strand; right to left second strand; left t0 rightLabel the 5' and 3' end of each strand_TACATGATCATTTCACGGAATTTCTAGCATGTA -ATGTACTAGTAAAGTGCCTTAAAGATCG

A double-stranded DNA molecule with the sequence shown produces, in vivo, & polypeptide that is five amino acids long: TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT Which strand of DNA is the template strand, and in which direction is it transcribed? first strand; left to right second strand; right to left first strand; right to left second strand; left t0 right Label the 5' and 3' end of each strand_ TACATGATCATTTCACGGAATTTCTAGCATGTA - ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT Answer Bank



Answers

The sense strand of a segment of DNA has the following sequence of bases: $$5^{\prime} \ldots TGGGGGTTTTACAGC...3'$$ (a) What mRNA sequence would result from this segment? (b) Assume that the first base in this mRNA is the beginning of a codon. What order of amino acids would be translated into a polypeptide synthesized along this segment? (c) Give anticodons for each tRNA associated with the translation in part (b).

Conscription process. The M irony, which is the messenger ribonucleic acid accorded by the template strand of the detainee sequence, is produced. Therefore, the M Irony Strand is given below. According to the genetic good. One can deduce that the poly peptide ordered by the garden present under a modern me that is the singer Rodney the bullet pick tight consists off. Manage to that is amino group end on C O H. That is car box will end that is closed by the above. A martini on it is as follows Now, if the G is to see reissue that this GC bear gets deleted by the mutation, then the mutated poly peptide would be as follows on the amino acid poly peptide. So produced is Dino did as follows.

This problem gives us a little bit of practice with the mechanisms of transcription. So we've got a DNA sequence here. We know that the sequence is going to be read from left to right. We know that from the problem. Uh, and we know that DNA is right in transcription from the three from 25 PM direction. So that's how we're gonna label this because it's red left to right. We're gonna go three prime 25 and therefore the anti parallel complimentary are today is gonna be five. Prime 23 And we're just gonna go ahead and synthesize this out and matchup based Paris to base periods with are in a nucleotides. And we can recall that t is replaced with you in our day that someone's gonna keep going here. Uh, so be you. Okay. A c she Jeanne, you see you Okay, G You okay? G g you, you and you. See you. Okay, just this. So essentially our job is done. Now we've, um, described which ends, or which ends 5.3 friends. We've synthesizer new are today and we've labeled at 5.3. So we're good

Okay, here. We've got a complimentary, um, double stranded segment of DNA, and we know that the bottom is the template, cause that's given in the problem. So when we convert this into our day, which is our goal of this problem transcribing into our name, we're going to use this strand, the Template Street. It's the template for transcription. We're gonna use this straight to determine what are are in a stream is gonna beat. And then a really cool thing about other street, which is called the Coding Street and or this is also called the or in a like strand is that it should match up with our transcribed are in a molecule, which is really useful because when we transcribe it, we could go back and check this. And with the exception of, um, substituting, you're so for time, me and they should look exactly the same. So that's exactly what we're gonna do. Uh, we're gonna drawn or any molecule, and we know that it's get that DNA is synthesized or I'm sorry, DNA. What? It's Crist grabbed is red in the three fought three printed five prime direction. But then our DNA is made five private, three primes. We're gonna start down here with our five products and we're century. Just gonna go code on bike, hoedown or nuclear type by nuclear time. I just transcribed all the way through so good. Go ahead and do that substituting yourselfer timing when necessary. Like in this case right here, when there's in you, right, and then we're gonna end it with a three prime so you could go back and check it with this one right here. So a you a g g c g a u G C C eggs. And that's correct. So this is our newly transcribed Are in a molecule.

This problem is going to test our knowledge of converting Arnie to DNA. We got a and we're industry. And down here in the bottom, that's this amount of base pairs long. We know that's 5% 3 crime. We need to get the complementary DNA double strand. And I think it would be easier to start out with the non templates during the coding street. And okay, go up here, make ourselves a little space for the D A. Um, so you got the coding strand and then the template street. We can recall that the coding strand is identical to the or in A except for the, uh, T U substitution. So we could go ahead and fill in what's going on there, and we know that it's the same, uh, running the same way five permit. Three prime. So, essentially, we're just gonna go and replicate it and filling the teas in place of the art. The are in a use. Everything else should be identical. This is a really handy trick for doing this. I think a little bit faster. Hey, Jeanne D C c. See, e g. Who? I'm sorry. He instead of you TCC Hey, a she g a g that got a little bit messy, but you made it. Okay, so that means the next grand is the templates trade. And this is gonna be complementary to this and this. It might be easier. Just simply transcribe the coding strand and filling its compliments. So we're gonna start three. Find a five prime T a. Si, si, si, si To t g I see g t t c t c Yeah. Si, si, si, si g Jeanne. Jeanne. Okay. See? Okay. G T, T c c T c. And that ended with the fire. And this is our template straight of DNA.


Similar Solved Questions

5 answers
Determine Determine the relative polarity ecules Predicting physica properties form molecular shapes Identify what type of intermolecular forces exist in the following molecule:will have = higher or lower boiling point than:NLiIn which of the above molecules would you predict it to be most soluble?
Determine Determine the relative polarity ecules Predicting physica properties form molecular shapes Identify what type of intermolecular forces exist in the following molecule: will have = higher or lower boiling point than: NLi In which of the above molecules would you predict it to be most solubl...
5 answers
2} M 9 # 1 2 G alerahon forGorc&' On 2 2 0 Joku ? 1 4 8 0 1 3 2
2} M 9 # 1 2 G alerahon forGorc&' On 2 2 0 Joku ? 1 4 8 0 1 3 2...
5 answers
A thermometer is removed from a room where the temperature is 708 F and is taken outside, where the air temperature is 10' F. After one ~half minute the thermometer reads 60* F. What is the reading of the thermometer at t = min? (Round your answer to two decimal places:) XHow long will it take for the thermometer to reach 30" F? (Round your answer to two decimal places ) min
A thermometer is removed from a room where the temperature is 708 F and is taken outside, where the air temperature is 10' F. After one ~half minute the thermometer reads 60* F. What is the reading of the thermometer at t = min? (Round your answer to two decimal places:) X How long will it take...
5 answers
Points) Supposa the shaded region Ihe figure , and f(x,Y) continucue {uinction Gr R; Find Ihe lmits ol integration for the lollowing iterated Integrals f(x,Y)da = Ef" f(x.Y) dydxI sna^ = EI" f(x.n) dxdy
points) Supposa the shaded region Ihe figure , and f(x,Y) continucue {uinction Gr R; Find Ihe lmits ol integration for the lollowing iterated Integrals f(x,Y)da = Ef" f(x.Y) dydx I sna^ = EI" f(x.n) dxdy...
3 answers
Bonus) Let beuniformly continuous D(O_ ad |-ol = any point on the boundary of D(O. 4) Prove that lim f(e) exists: Further_ let 9(2) = f(e) if |el < 1 and g(=) XFk<1 lit f(a) if |:l = 1 Prove that is continots O1 DOO, ie can bx contiqouskv Xek<1 exteudedl to D(, (Bonus) Let u(i; y) = f(el): Prove (hnt is harmonic on € {0} if and ouly if u(I. v) a In /:l+6.
Bonus) Let beuniformly continuous D(O_ ad |-ol = any point on the boundary of D(O. 4) Prove that lim f(e) exists: Further_ let 9(2) = f(e) if |el < 1 and g(=) XFk<1 lit f(a) if |:l = 1 Prove that is continots O1 DOO, ie can bx contiqouskv Xek<1 exteudedl to D(, (Bonus) Let u(i; y) = f(el): ...
5 answers
Find the lines that are tangent and normal to the curve at the given point.x2y2 64 ,(-1,8)The line tangent to the curve x2y2 =64 at ( - 1,8) is y =
Find the lines that are tangent and normal to the curve at the given point. x2y2 64 , (-1,8) The line tangent to the curve x2y2 =64 at ( - 1,8) is y =...
5 answers
Find zw andWrita each answer in polar form and in exponontial form_273 co8slnw=6 cos 9sin 0The product zw in polar fomm is and in exponential form is (Simplify your answer: Type an exact answer; using as needed. Use inlogers or fractions for any numbers in the expression:)Tha quotient in polar Iorm Isand in exponential (orm Is (Simplily your answer: Type an exact answer; using as needed. Use Integers or fractions for any numbers In the exprossion:)
Find zw and Writa each answer in polar form and in exponontial form_ 273 co8 sln w=6 cos 9 sin 0 The product zw in polar fomm is and in exponential form is (Simplify your answer: Type an exact answer; using as needed. Use inlogers or fractions for any numbers in the expression:) Tha quotient in pola...
2 answers
(15 pts) A public key cryptosystem based on RSA is used to encrypt messages. The public key Or encryption function is (e, n = 65.247) Find the ciphertext C if the plaintert Wis 131_ Determine the prime factors of 247. What is 0(247)2 What is the multiplicative inverse of 5 mod 0(247)2 You are given the ciphertext € ' = 83. Find the plaintext V' . What is the RSA decryption function (d,n)? Check that the M' you determined is right:
(15 pts) A public key cryptosystem based on RSA is used to encrypt messages. The public key Or encryption function is (e, n = 65.247) Find the ciphertext C if the plaintert Wis 131_ Determine the prime factors of 247. What is 0(247)2 What is the multiplicative inverse of 5 mod 0(247)2 You are given ...
5 answers
Conver 9e 0t diverge?and Compu-e + Sum a ) 2 4.5 12 s 0 3125b ) 7o (@)^ C.) 7 4 d)Z (s(#) nei Yn e ) "cYn+i 7
Conver 9e 0t diverge?and Compu-e + Sum a ) 2 4.5 12 s 0 3125 b ) 7o (@)^ C.) 7 4 d)Z (s(#) nei Yn e ) "cYn+i 7...
5 answers
This Use 400x magnification. Wl times true. ) that the size information to of view the diameter of the field of difference ofthe field Show how you figured it out calculate the there 1 approximate get larger or smaller as magnification S diameter Lio V and 40x 1 any of view 400x? change Smaller JX magnification: (This
this Use 400x magnification. Wl times true. ) that the size information to of view the diameter of the field of difference ofthe field Show how you figured it out calculate the there 1 approximate get larger or smaller as magnification S diameter Lio V and 40x 1 any of view 400x? change Smaller JX m...
5 answers
Stop-to-Think 21.4 0n page 583. In particular:Answer the question asked. (what` wrong with the energy-transfer diagram? ) Does it Fiolate the first law , the second law , or both? Fix the energy-transfer diagram S0 that it represents possible refrigerator. There are two ways of doing this by chauging Oue value in the diagram YOll MAY do either one. Find the coeflicient of performance k for the refrigerator YOu sketched out in part (6).
Stop-to-Think 21.4 0n page 583. In particular: Answer the question asked. (what` wrong with the energy-transfer diagram? ) Does it Fiolate the first law , the second law , or both? Fix the energy-transfer diagram S0 that it represents possible refrigerator. There are two ways of doing this by chau...
5 answers
(-2 Pointa]DETAILSLRcaLon75.408.MY NOTESASK YOUR TEACHERPRACTICE ANOTHER(conside the lollcringF(x)1) dt{0) Integratcfind Fafunctlon & XF(x)WentenstmneDecono Fundameca IneoremtCalaulsdilferentiating the resuit can (2.Need Help?
(-2 Pointa] DETAILS LRcaLon75.408. MY NOTES ASK YOUR TEACHER PRACTICE ANOTHER (conside the lollcring F(x) 1) dt {0) Integratc find Fa functlon & X F(x) Wentenstmne Decono Fundameca Ineoremt Calauls dilferentiating the resuit can (2. Need Help?...
5 answers
Q3 (24 Points) Suppose X is compact metric space and f :x+Ris contintous function: Prove there exists p e X such thatf(p) sup f(r) rex
Q3 (24 Points) Suppose X is compact metric space and f :x+Ris contintous function: Prove there exists p e X such that f(p) sup f(r) rex...
5 answers
[+1 Polnes]DETAILSSCELCE186.4023MI:My NOTESASK YOUR TEACHERPRACTICE ANOTHERAeatEalatcemmgeHuluanmrne tnane aemeatFna4Nood Holp?3naanan
[+1 Polnes] DETAILS SCELCE186.4023MI: My NOTES ASK YOUR TEACHER PRACTICE ANOTHER Aeat Ealat cemmge Huluanm rne tnane aemeat Fna4 Nood Holp? 3naanan...

-- 0.048402--