4

An athlete tralning100long Ilnear track: Hls motlon described by the graph hls posltlontime nelowt(s)30(a) For each segment of the graph, find the magnitude and dir...

Question

An athlete tralning100long Ilnear track: Hls motlon described by the graph hls posltlontime nelowt(s)30(a) For each segment of the graph, find the magnitude and direction of the athlete'$ velocity. magnltudedirecLionmagnitudem/sdirectionIna Mb Anitudemagnltude Remember that velocity the change position per the change time. If the graph plots position about the Inltial flnal tlmes and posltions for cach segment. ms direction nenstretimer what property of the ploteach segment relatedvelocity?

An athlete tralning 100 long Ilnear track: Hls motlon described by the graph hls posltlon time nelow t(s) 30 (a) For each segment of the graph, find the magnitude and direction of the athlete'$ velocity. magnltude direcLion magnitude m/s direction Ina Mb Anitude magnltude Remember that velocity the change position per the change time. If the graph plots position about the Inltial flnal tlmes and posltions for cach segment. ms direction nenstre timer what property of the plot each segment related velocity? Think magnitude M{s dlrectlon positive (D} What are Lhe magnitude and direction the aLhlete' $ average locily over the entire 60 interval? magnitude dircction Hasilive *



Answers

An athlete starts at point $A$ and runs at a constant speed of $6.0 \mathrm{~m} / \mathrm{s}$ around a round track $100 \mathrm{~m}$ in diameter, as shown in Figure $3.34 .$ Find the $x$ and $y$ components of this runner's average velocity and average acceleration between points (a) $A$ and $B,$ (b) $A$ and $C,(\mathrm{c}) C$ and $D$ and (d) $A$ and $A$ (a full lap). (e) Calculate the magnitude of the runner's average velocity between $A$ and $B$. Is his average speed equal to the magnitude of his average velocity? Why or why not? (f) How can his velocity be changing if he is running at constant speed?

Here we have a runner running on a circular track. This is a case of uniform circular motion that there is no change in the radial direction as the runner runs around the track and the runner stays on the same plane of the track, that is his path has no component in the access that points outside the plane of the page here. So we will denote that in a diagram for further solution in this problem as follows, well, denote his position, but will denote him rather as a red dot Him or her, I should say. And, um, we're gonna mark that position with a position vector that will call our go. Gonna call that vector Art of Marcus, position the runners position. Okay. The runner also has a instantaneous velocity that's tangential to the path. We're gonna mark that us Another vector veteran. I'm going toe mark in blue and we're going to call this velocity vector vector V. The magnitude of this instantaneous velocity is the tangential speed which is given in the problem of six meters per second. Another critical piece of information that they give us in this problem is the size of the path itself, that is, it has a diameter of 100 meters per second. I'm sorry 100 meters and that's equal to a radius of 50 meters. Let's actually used proper notation here. Diameters 100 meters. The radius is 50. Cho, that's better. The problem asks us to find the X and Y components of the average velocity and the average acceleration between two points and in each part of the problem is a different set of two points that we will consider. So before we get started, let's go over the relevant formula for average velocity and again, velocity is a vector will continue with that notation, but we're gonna denote that it's an average rather than the instantaneous with the subscript a V. This average is actually the difference of the position. Vector of the endpoint will call that our sub f minus the position vector of the runner at his starting point for our survive for initial. And we also need to know because it's a velocity position over time, the final time to traverse that path when he ends up our sabbeth and this is often denote a more compactly, this expression as the difference in position. The different specter over the difference in time for two points. The average acceleration is very similar quantity. Structurally. However, rather than having positions in the numerator, we have velocities in the numerator. So we have vector Visa Beth Final point again. That's a vector minus the initial velocity. And this is again like the expression above over the final time, minus the initial time and the compact way. And I believe this is how it shows up in the book or how they denied in the book is the difference in vector velocity of the difference Vector of velocity over the change in time for the two points in the past to take care of this time because we're going to use the known information about the tracks geometry that it's ah perfect circle of, um diameter 100 meters. We're going to use that information to compute the time it takes this time for a complete lap is the total distance of that lap, which we know from geometry as pi times the diameter Mr. Conference, divided by the speed at which he traverse is that distance we call s for our specific numbers here we have 314 meters divided by our speed return. Tangential speed of six meters per second, 52 and 1/3 seconds. We'll need this lap time for future. Part of the problem the first case acts asks us to compute the average velocity the specific components of which between two points along the path point A this location on the circle to point B. This location these, um just as we did for the runner up above, we can show the position vectors of these points. We're going to call each them R C B and our Sabei respected these with the arrows or both Vectra quantities. Also for in order to compute the average accelerations, we need to show velocities as well here velocities air tangent to the path, going to note them with blue arrows. And I'm going to call them peace be vector and visa. They vector respectably using the formulae we, um, worked out above or looked up and wrote down above, we can compute the average the las thing ab ridge velocity and average accelerations. Now to compute the actual average velocity and average acceleration vectors for average Palat velocity It is a vector quantity and which we're gonna note as the vector with the sub script at a B for average, compute the difference of the position vectors over the change in time for this case from a to B, we have for our sabih the magnitude of the radius of the circle and it is pointing in the positive Y direction for the initial vector are Sabei. It also has a magnitude the radius, but it is pointed in the negative X direction the in terms of the proportion of the total lap. This distance from A to B is 1/4 lap. So because he's going a constant speed, it's going to take 1/4 of the total time to traverse those two points. I'm sorry. That should be a four for 1/4 here of the total time separating these out into component over tea for the X component. We're subtracting a negative, so it remains positive. So we're writing it rather is positive in this case for the y component. It also has a coefficient of four are over tea. It's in the positive. Why direction now a similar process for computing the average acceleration But instead of having position factors in the numerator this time we have velocity vectors. So being a fractional quantity, here we have the final velocity vector. These be It has a magnitude of the tangential speed s. It's pointed in the positive X direction for the starting velocity. The initial velocity is Visa Bay it to has a magnitude of s and it is pointed in the positive Y direction. The same amount of time is required to diverse between these two points each with these respective velocities. As we said above, that's 1/4 of the total lap time. So we'll put that here for the change of time in the denominator writing. These separate components were left with for s over tea in the X direction. And that's a positive quantity. Positive direction we are left with for us over tea for the y component. But since we had to subtract here and why was positive, we're subtracting a positive. We have to put a negative sign there the y direction and that is our average acceleration. Just a sanity check. Let's confirm that these quantities actually makes sense geometrically for a difference in position. We point narrow from the initial to the final. That's position difference. So this vector should have a positive X component and a positive. Why component? According to this, according geometrically and just for clarification sake, let me to note this as Delta are from a to B, does that agree with the value we worked out? Well, it has a positive X component which is going this direction, which is correct. It has a positive why component, which is going upward, which is correct so geometrically things are aligned. What about the case for the velocity vectors? We can't really add them the same way. So I'm gonna put add them together here in a different space. Positive for V A and we got or an upward for a and we got a, um, rightward going for visa Be Let me see if I can't make these what originate correctly here. That's better to dio a vector difference between these. We go from initial to final, as close as we can get it. Yep. And I'm gonna denote that as dealt, uh, the from A to B Victor. So according Teoh, what we computer dear, this factor should be positive going the X direction it is. But it should be down. We're going in the Y direction Negative going. It's pointing downwards. So that is also in line with, um what we computed. Finally, let's plug in the numbers to see what these values be numerically for the case of average velocity are coefficients are for our over tea. This is four times 50 meters divided by 52.3 uh seconds which leaves us with 3.8 to meters per second for each of these coefficients in the, um for the expression for average velocity for acceleration are coefficients are for s over tea which IHS in our case inserting values We have four times six meters per second Vita by our 52 point three seconds we're left with 0.459 zero point four 59 meters per second per second, which is an acceleration quantity. If you wanted new miracle vectors here, you would insert 3.82 for four are over tea You would insert 0.459 for the four s over tea Let's box thes continuing to our next case here We're being asked to find the average velocity going from point A to point C in the book Point A is where it was last time Point sees on the other side of the track. Let's use My style is here. Point sees on the other side, the track that's better. Let's draw some position vectors, okay? And let's labelled an They are vectors. So they get the arrow Super scripts, the your whole head the still a similar procedure for velocities. Just in the case of last time, the initial velocity is upward and the velocity at point C is downward in the Y direction. It's label him. Okay, Now let's do a computation. Same procedures last time. The average velocity here is the position factor at the end point are subsea, which has a magnitude of are disappointed Positive X that, um in point position vector minus the starting point position vector. So our Sabei is also has a magnitude of our and it is pointed in the negative X direction. Last time we saw when we did a quadrant, that was 1/4 of the total lap time in orderto traverse between these points from a to see, this is 1/2 lap so rather Navid. 1/4 in the denominator like last time. We'll have 1/2 of the total lap time for the change of time. Breaking these into components leaves us with ar minus and negative is to our times two. So, again, we have four are over tea for a coefficient in the X direction we have no why component here? Both of our position vectors have no white component, so it is simply a, um, component with zero magnitude. Do. Now, let's look for the average acceleration instead of position vectors, we now have velocity vectors in Yeah, numerator are the velocity vector at the end. Point C has magnitude s speed and has pointed negative y direction. You're going to subtract our initial velocity vet care at point A. It has a magnitude of s and it is pointed in the positive Y direction. There are no X components to either these vectors, same amount of time has passed between them and each of these points 1/2 the total lap time and writing these a separate components, we have a negative y minus A Y leaves us with, um, negative to s. And we're dividing by 1/2 which is Samos multiplying by two. We have negative for s over T for our white component is said before these velocity vectors have no X component. So that is a zero x notice. These are the same values as we computed above. Um, numerically, if you want a new miracle answer in this case, you would insert those in each of these coefficients. We will box, then onward. Next, we want to compute the average acceleration and average velocity vectors for the case of going from point C to point d. Show these on her diagram. Here, Point C is here. Point de is here. Position vectors like last problem point C goes there from the origin to its location at the intersection of the X axis. The, um, position vector for point d goes, uh, downward to their See if I can move this guy much. That's, uh, label them. These were position vectors using our stops using our to denote position decision factor to end point D to notice our city vector. Let's put in the velocities for this problem. Velocity points directly downward from point C for our starting point, and it points in the negative X direction at Point D are in point. Let's mark them, label them plus de vector. See velocity vector de are in point. Let's do the computation, Justus. We did in two parts before our average velocity. In this case, from C to D. It's going to be the position vector at the final point RCD, which has a magnitude of our pointing in the negative y direction. Our starting point is Point C, which, um, we did notice. Vector has a magnitude of our and it's pointed in the positive direction again. This is the difference between vectors. So we have a negative sign subtracting initial from final we the difference between difference in time between initial to final. This case is a perfect quarter lap time, so we'll write that down is 1/4 T. And if I can't make these smaller, make my life a lot easier and go to the next line. So let's try to do this better, Okay? Writing out a separate components. Let's start with the X. We have for oh are over tea and it is negated. It's in the negative X direction now for the y component. It too is negative and it's coefficient is the same. Just this insanity Check our position. Our difference in position vector oops goes from C to D. It should have a negative x component. It should have a negative white component. And indeed it does. So I'm trusting our solutions So far, let's quickly denote that is Delta Oh, from C to D for the case of our velocity Vector fuel. Imagine we take this. See? Put it down here. It's difference would be that orientation which indicates a, um, negative x component, but a positive why component. So let's see if our answer turns out that as we calculate the average acceleration here back to her black pan acceleration average, you do the final velocity. Just going to be s negative going in the X direction. No, let's do that Right. X negative going in the X direction. There we go. Minus the initial velocity has the magnitude of s and it's negative going in the Y direction. It takes 1/4 lap. Time to go between those two points. Just before writing these out a separate components, we will have a negative for s over tea for the X component a positive four s over tea for the y component are geometrically. Our director had that orientation. Um, so that corresponds with the negative going X component and a positive going wide component. So our sanity check once again lands us to believe this. Correct. So let's box thes now will consider the case for going from point A to point A in a full lap. Well, going from point A as an initial point to point is, a final point means that our position vectors are equivalent taking a difference. Um, between equivalent vectors ends up with the zero vector, the no vector as the result in the numerator of our, um, quantity for average velocity. So let's just plug those in as we have in the previous versions. And if we have a no vector of top, that's truck, regardless of how long it took full in. Not in this case, a full lap. We are left with a zero in the for an X component zero for a why component. The same thing applies in the case for average average acceleration are, um, initial velocity and final velocities are equivalent. So we're again left with a zero vector in the numerator, regardless of the amount of time it took to go that full lap. So our acceleration vector is no. Both components are zero. Let's box these next. The problem asks us to calculate the magnitude of the average velocity. In the case of going from A to B, we have that vector from above the average velocity I need to calculate its magnitude. So just to remind us here, so the magnitude here, we need to square each component and then add them. Take the square root of the result we got, which, after a little sleight of hand here we know is four route to you are over tea. Now recall A from the very beginning of this problem the, um, magnitude of our instantaneous velocity not of the average velocity, but the instantaneous felt velocity they gave us as s, which was equal to six meters per second. This, um, magnitude of the average velocity. Now, um s we can write as the circumference over the lap time. There's a conference. We know he is to use my stylist better. Maybe, Maybe so. Maybe not two pi over our over the total lap time Now, if we compare that to a result that we got here for route to over tea times are we can see that four Route two into pi or not equivalent. So for this next part of the question asking if the magnitude of the average velocity is equal to the tangential speed, When you express each of these symbolic terms, we see that they're not equal. Why is this? Well, you'll notice that when we compute an average velocity, we're including on Lee The path boundaries were ignoring all of the velocities that occur along the path in between those boundaries. But by the fundamental theorem of calculus, the closer together that we put our, um, our sit by and our sub f position vectors along that curved path the closer, the resulting average, the value of the resulting average velocity will be to the actual tangential speed average velocity, magnitude. Um, for the case of 1/4 quarter lap, I computed Teoh be around 5.8. I'm sorry. 5.4 meters per second, which is a little bit less than the given value of tangential speed of six meters per second. But that is at least closer than the case of the going from Point A to Point C, which was the um, half lap case that one was merely the 3.82 meters per second she's getting further away. In our case of a full lap, Um, that was one full lap recall that we had zero meter per second, um, tangential speed. So the shorter the distance between the, um, starting point in the end point along your path the closer at least by this inductive argument here, the closer that magnitude will be to actual final um, part of this problem asks if how is velocity changing if the tangential speed is kept constant? And that's because even though the runner is running at the same speed along this circular track as he goes around the track, his position, his direction, the direction he's facing at the direction, um, that he's running gradually changes and, um, velocity changes not only can be changes in magnitude, they can also be changes in in direction, or they can be both changes in magnitude and direction. And for our case, it was just a directional change as the runner goes around his the circular track so well, quickly write this as because of directional change. No

Given the diameter off the circle, we can find the radius using the half off the diameter. So this is going to be 50 meter. And using this value ofthe videos, we can mark the components off Evie City. As so it will be minus har co Macedo coordinates off Leap, baby baby Ciro Less Seo less Taj saves sees going. Toby AJ Segal Andi will be given by the points Teo and art on were given the tangential velocity. Uh, so velocity at each point on the circle is going to be a tangent. Abandon ship in tow. The part at that point. So these are going to the direction of velocity at which all this points and since the magnitude is gone, stoned began Mark the confidence of velocity. Yes. So it cited him. Do koala set point A. This is going to be CTO. I mean, my point being this is goingto believe Zine cto Similarly, 4.6 will see you minus v on that, Dean, this's going to be minus Please you. So if you're confused about how I used the velocity, let me just repeat again. So the direction off velocity at point a is upward on. There is no component off velocity along X direction. So velocity along extra diction, the competent of the lot stay along extra addiction. It's going to be zero on DH on the confident of velocity, and my direction is going to be V or six meter per second. And since the direction is upward, this is going to be positive. Similarly at point B. This is moving. This is pointing towards a positive X axis and there is no component of molesting all my directions of that is going to proceed or on DH. The exact says This will be given by you for seeing velocities downward and only in the white direction, negative direction. So ex company and, uh, velocity will be zero on my component is going to be AA minus three because after down outside and some relief appointed now, for the first part, we find, ah, the Valium for one loop, one full lap, which is the time taken by the particle toe. Make one full round off the circle. So this will be given by the total land or the total Sark informants off the circle. So that is going to be by God over the velocity, which is constant and is given by six meter per second. And this gives the timeto be 52.4 seconds. This is sometimes called as the time period because this is the time taken by the article to make one full drunk. So from here, Toby Ah, we see that this is just 1/4 lap. So from a to B, the time taken, that would be 1/4 off the total dying. So this will be then hurting 0.1 seconds. Now we can find the average velocity along except my direction. It's a long X direction this the people. And by changing the garden, it's off x over the time taking to move from the trapeze. So this is the basics. A minus x bean old vanish on that day it is. Do it. It's an X in Seattle X being Ah, OK, so just imagine it. This should be finer distance minus the emission distance. When we say don't like, they should be finalised ins, which is X B minus 60. So, yeah, now we can right X B. That is Siegel minus X A. This is negative. Odd and God is 50 meters or what they may be So the sausages and beget this value. Toby CCI Point In a couple seconds, we do the same thing for the wind direction. So this is going to be dead by overdone lt on Del. Why is Wybie my ex wife? Oh, right. Maybe. And this value is through on tape. Next we have to find the acceleration. So acceleration is average. Acceleration is basically the changing velocity over the time taken. So this is going to be the ex. Some bell, the X or wise then so from a Toby along extra diction we have We'll be in the extreme to be equal to V, which is six meters per second. The X A is Siegel Sandel days. The value that we can collected here just stick baby from this lugging that I lose, we found circus is V 26 minus Siegel Mitt off a second forward time. It's a starting point monster. This is it called a 0.6 Need a ballistic second Middle Signet's grand. We did the same thing for acceleration and my direction. So this will be there will be wind over Del so confident. All the light. Sorry. Accompanied of velocity along my direction. I find minus levi at point B, divided by eight. And this will be quite negative. Zero point. Poor six. Me dip a sick? No, this is the first part. Now, for the second part. You see that from 80 see, this is no half lap because it covers half the silk influence off the circle. So the time taken will be half off the time period, which is 52.4. So be is even being baffled. 50 to 14 seconds and this is equal to 26 point two seconds. Now we can find the velocity using the same question as they used before. Except this time the after use Hello. The coordinates at point C instead. Off point. This is a quantity 0.8 meters per second. Similarly fine, Mrs Quito. Then light nobody lt. And you'll see that this is equal to zero. Similarly, the average acceleration will be then the ex or weird. Lt This is being re X C minus Nick's age over being a C. So sometimes I'm writing liaising. Sometimes I'm letting this year, so don't get confused about their They're basically the same. This is a Cueto. Cedo on why I have edges. Go on. This is going to be called. No. Get syrup on for six meters per second. Now I'm pretty sure you must have. I got an idea about how the things are walking. So for the third part, we have to do the same thing Gone C o D. Which is again 1/4 lap. So be seating is basically one fought off the total time, and this is again going to be hurting 0.1 seconds Minutes. I do the things fast because now you have an idea off too. Uh, could these things done on the next? This is going to be CTO minus to me. Well, we're 13 going one second. The three point dates events, acceleration averages. So remember when you're dating the coordinates, make sure you're taking them corresponding to these two points. And always you might ah, get you don't got so that is toward by for the last part, you have to find from a tow A So that is one full round. Right? So he is going to be called to the time video, But since the particle returns back toe the original position, they'll x on Gail White are goingto zero, and so will be the ex Andi by at this put the average velocity along extraction and average velocity in my direction. So if you if we use those values to find the acceleration on the velocity, those are also going to because the serial, because telex, Then why does the X and they'll be going to prison? Let's just like all those values, something X And like I said, Oh, on DH. So this gives the ex average on DH the guy average to be quite a zero using this tone questions also then re X on delivery y our sio on this gives that average acceleration a long exam duration of zero for the fifth. But we have to find the magnitude ofthe the object's velocity. This is going to be equal to route over, off the some off the square off the components. This is for it to be so we're going to use B X and B by average, corresponding to these points that is goingto be despite because, yeah, so we lose these two values. So this is going to be going t 0.8 square. That's 2.8 square, and it's not writing the units to save some time. But when you do, the calculation makes yours. You taken off the units there, so the speed is gone stoned. So the average speed is six. Meet up for a second. Over here, the average speed is larger than the magnitude ofthe the average velocity because that because the distance traveled is larger than the displacement. So what I want to see is this is the average speed on the one we found. Here is the average velocity. Now, average speed is given by the change in distance over time. On average, velocity is given by displacement. Overtime and displacement is the shortest distance. So if you say from it to be, then the distance is visibly this ark like displacement, they will be basically the line joining these two points. So this land, the ark is obviously greater than the slime. And that's the reason, uh, the average speed the straighter than after its velocity. So I've answered, in fact, makes sense from the fifth flag. Ah, since velocity is a vector that put magnitude and direction. The magnitude ofthe the velocity is constant, but its direction keeps on changing. So that's right, baby, which is the magnitude which we found on the 5.4 meters per second. It's going to be constant with Tita, which is the angle needs by the velocity on the magnitude ofthe this velocity. The velocity vector with the exacts is he's going through teams Did Michelle. How so? At this point velocity the direction off velocity is going to be like this from they don't see This is going to be like this from C today. This is going to be like this and same for deed to a handful at the points.

Alright, we're given a position versus time graph which looks kind of like this. Um Let me see here, I need to look at the book, position versus time. Okay up down over over so goes up down back to the book. Uh Okay and then we've got a B C. D. Already. Okay so velocities, so again this is position versus time. So if the slope is positive, that would be a positive velocity, that would be a and also see positive velocities, negative velocity would be a slope negative going downward. That would be B. And zero velocity would be horizontal. That's d Okay let's look at the next was the average velocity for each segment. The average velocity is just the slope. So for a rise over run Is going to be rise 1.25. Run 0.2. Um For B it's gonna rise negative, It's going to go from 1.25 to 0.5. That would be negative .75 & 0.2. Again. See This one's going up .25 and over .4 and d Rise zero Run 0.2. Well at least I can do that calculation in my brain. Trying to do this calculation in my brain. That would be um five 8th. Which would be 0.625. So I can do that one. Um points so 75 over to -75 over to. That would be 37. a half. So -37.5. 125 over to. That would be 62.5 who I did not use a calculator. All right. Thank you for watching.


Similar Solved Questions

5 answers
Q2. Determine the number of iterations necessary to solve f(x) = e-= cos(x) = 0 with accuracy 10-` using the Bisection Method on the interval [2,7].
Q2. Determine the number of iterations necessary to solve f(x) = e-= cos(x) = 0 with accuracy 10-` using the Bisection Method on the interval [2,7]....
5 answers
NAME(print) [10] The pH ofa 0.200 M formic acid (HCOOH) solution is 2.23: Determine the Kof formie acidA solution is prepared by mixing 100.0 mL of 0.1OM Pb(NOs)z with 100.0 mLof o.1OM KCI If the Ksp of PbClz is 1.6 X1O 5, does precipitate form? [15]Determine the concentration of Pbz+and Cl- in the mixture:
NAME(print) [10] The pH ofa 0.200 M formic acid (HCOOH) solution is 2.23: Determine the Kof formie acid A solution is prepared by mixing 100.0 mL of 0.1OM Pb(NOs)z with 100.0 mLof o.1OM KCI If the Ksp of PbClz is 1.6 X1O 5, does precipitate form? [15] Determine the concentration of Pbz+and Cl- in th...
5 answers
Top: viewtwo coaxial solenoidsb
top: view two coaxial solenoids b...
5 answers
Chapter Review Excrcises, Question 040Incorrect:Find the exact area below the curve Y = x5(1 _ x) and above the~axis.Click here toenter or edt_Your_answerArea3 0Click if you would Iikc to Show Work for this question: Open Show WorkShow HINTLINK TO TEXT
chapter Review Excrcises, Question 040 Incorrect: Find the exact area below the curve Y = x5(1 _ x) and above the ~axis. Click here toenter or edt_Your_answer Area 3 0 Click if you would Iikc to Show Work for this question: Open Show Work Show HINT LINK TO TEXT...
5 answers
GTGCATCTGACTCCTGACCACAACANATranseriptionRNAIIlonFratein
GTGCATCTGACTCCTGACCACAAC ANA Transeription RNA IIlon Fratein...
5 answers
Q6. In conductometric titrations data point away from the endpoint is important whereas, in potentiometric titrations data point near the equivalence point is important: Explain
Q6. In conductometric titrations data point away from the endpoint is important whereas, in potentiometric titrations data point near the equivalence point is important: Explain...
5 answers
11. Ifthe probability of a second round NBA draft pick actually making the team is what Is the probability that exactly 23 of this year'$ 30 second round picks will earn spot on team'$ roster? (6 points)
11. Ifthe probability of a second round NBA draft pick actually making the team is what Is the probability that exactly 23 of this year'$ 30 second round picks will earn spot on team'$ roster? (6 points)...
5 answers
The frequency Childr distrbution en below Frequency 1 the number children in families at a church MHinneapoNext Question mecian
The frequency Childr distrbution en below Frequency 1 the number children in families at a church MHinneapo Next Question mecian...
5 answers
Select C or $ for the blank so that the resulting statement is true {0~9, 0, 9 } ~ { -9, ~7,7,9} Choose the correct symbol below4 C
Select C or $ for the blank so that the resulting statement is true {0~9, 0, 9 } ~ { -9, ~7,7,9} Choose the correct symbol below 4 C...
5 answers
Water has an unusual phase diagram: Althaugh the pressure, (Fill in the blanks with the correct terms)point increases with increasing pressule,theFnnt DIera(MLiquidSolidL 0.006 atmVapor 0.01*C1OPCOCC TemperatureSelect one: boiling; freezingfreezing; boiling triple; freezing triple; boiling
water has an unusual phase diagram: Althaugh the pressure, (Fill in the blanks with the correct terms) point increases with increasing pressule,the Fnnt DIer a(M Liquid Solid L 0.006 atm Vapor 0.01*C 1OPC OCC Temperature Select one: boiling; freezing freezing; boiling triple; freezing triple; boilin...
5 answers
A tank is is half full of oil that has a density of 900 kg/m? Find the work W required to pump the oil out of the spout: (Use 9.8 m/s? for g. Assume r = m and h = 3 m.) W = 310413703.95 X ]
A tank is is half full of oil that has a density of 900 kg/m? Find the work W required to pump the oil out of the spout: (Use 9.8 m/s? for g. Assume r = m and h = 3 m.) W = 310413703.95 X ]...
5 answers
Write truth table for the statement p /Use De Morgan s laws write negations for the statement: The connec tor is loose Or the machine is unplugged_Verify the logical equivalences . Supply Teason for each step_ (PV
Write truth table for the statement p / Use De Morgan s laws write negations for the statement: The connec tor is loose Or the machine is unplugged_ Verify the logical equivalences . Supply Teason for each step_ (PV...
4 answers
Determine the intervals on which the following function is concave up or concave down. Identify any inflection points.g(x) = 3t5-25t4 +40t3 +100(1)The function is concave up on ( ) and concave down on ( ).(2)An inflection point occur at t = ( )
Determine the intervals on which the following function is concave up or concave down. Identify any inflection points.g(x) = 3t5-25t4 +40t3 +100(1)The function is concave up on ( ) and concave down on ( ).(2)An inflection point occur at t = ( )...
5 answers
Determine the validity of each the following arguments. Ifthe argument is one of those listed in the text, name it.She uses e-commerce or she pays by credit card.She does not pay by credit card._________________________________________She uses e-commerce.
Determine the validity of each the following arguments. If the argument is one of those listed in the text, name it. She uses e-commerce or she pays by credit card. She does not pay by credit card. _________________________________________ She uses e-commerce....
5 answers
Gm Une 4ueun(nboc) 7,mncn(bociAlinc)"Boc 0 mCi-o"nc'entn7eBertNmnamelal)infearn |GenumlaJJnnmEloruna Iao ILeenentnen Meemn-tuniedon %trann u atlrEanartint TrMay letulntoran II0774e
Gm Une 4ueu n(nboc) 7,mnc n(boci Alinc) "Boc 0 mCi- o"nc' entn7e BertNm namelal)infearn | Genumla JJnnm Eloruna Iao IL eenentnen M eemn-tuniedon % trann u atlr Eanartint TrMay letulntoran II 0774e...
5 answers
The plasma drug concentration, Cp, was measured as22.51 mg/L and 8.668 mg/L at 2.013 hours and8.952 hours following a IV bolus dose, respectively. It isknown that in first order kinetics Cp =Cp0*e-kt andtherefore Cp0 = Cp*ekt.Please calculate the average initial plasma drug concentration,Cp0, from the given drug concentration versus timedata.
The plasma drug concentration, Cp, was measured as 22.51 mg/L and 8.668 mg/L at 2.013 hours and 8.952 hours following a IV bolus dose, respectively. It is known that in first order kinetics Cp = Cp0*e-kt and therefore Cp0 = Cp*ekt. Please calculate the average initial plasma drug concentration, Cp0...
5 answers
2 . Determine the ground state electronic configuration of Nz bond order, and all possible terms for molecular electronic states.
2 . Determine the ground state electronic configuration of Nz bond order, and all possible terms for molecular electronic states....

-- 0.023195--