5

Question 2.1 Use the symbolization key below to symbolize the following sentences of English in FOL. 3 points eachdomain: cities a: Vienna b: Berlin c: Paris Fx: is...

Question

Question 2.1 Use the symbolization key below to symbolize the following sentences of English in FOL. 3 points eachdomain: cities a: Vienna b: Berlin c: Paris Fx: is a French city.Gx: LX is a German city. Ox:_x is old Exy: LX is east of Wxy: _* is west ofNeither Vienna nor Berlin are French cities b) No German city is a French city Not all German city are east of Paris_ Only German cities are west of Vienna There are no two cities that are both to the east of each other: f) For any city, if there

Question 2.1 Use the symbolization key below to symbolize the following sentences of English in FOL. 3 points each domain: cities a: Vienna b: Berlin c: Paris Fx: is a French city. Gx: LX is a German city. Ox:_x is old Exy: LX is east of Wxy: _* is west of Neither Vienna nor Berlin are French cities b) No German city is a French city Not all German city are east of Paris_ Only German cities are west of Vienna There are no two cities that are both to the east of each other: f) For any city, if there is a German city to the east of it; then it is a French city



Answers

Translate these statements into English, where $R(x)$ is "x is a rabbit" and $H(x)$ is " $x$ hops" and the domain consists of all animals.
$$
\begin{array}{ll}{\text { a) } \forall x(R(x) \rightarrow H(x))} & {\text { b) } \forall x(R(x) \wedge H(x))} \\ {\text { c) } \quad \exists x(R(x) \rightarrow H(x))} & {\text { d) } \exists x(R(x) \wedge H(x))}\end{array}
$$

Here in this problem, we were told that, you know, that's why is the statement acts as the capital of why. And we want to know the truth value of the following state of the following sentences. Hey, we want Q of Denver colorado. Denver is the capital of colorado. And so this is a true statement on the we want Q of Detroit. Michigan Detroit is not the capital of michigan Lansing is and so this is false. Yeah, On C we have Q of massachusetts, boston, massachusetts is not the capital of boston. The other way around would be true, but this one is not true in this order, so this is false and then indeed we have new york, new york and Albany is the capital of new york. It means this is false. Mhm.

Hey, it's Claire. So when you read here, So we're gonna translate these qualifications into an English statement and were given that the domain in each case is all real numbers. So if we look at part, eh? We see that there is the existential quantification, which means that there exists in the universal, which is for every or any. So there exists in the real number X that one multiplied by any your real number. Why results in the value of that rial number? Why? For part B, we see our universal, which is for every or any, and we see that if then symbol and the end. So the product of two negative real numbers is positive part. See, we see our existential, which means there exists. We see the and symbol, and we see the larger than and smaller than symbol. So there exists to real numbers X And why such that the square of the rial numbers X is larger Thani the other number Why and the rial number X itself. It's smaller than the other number. Why, then finally, for party, we see the universal symbol, which is for every the existential quantification, which means there exists and we see the equal sign. So for every to really numbers, some of the two really numbers is also you're really number.

Okay. What does that translate to you? A naked concentration in English. So we have. There's just some X for all. Why? That explains why is it twice? It seems that they're just some rule number. That's that all values room numbers of why experts why is equal to the rule number way. But B, we have all away, I think so. And why I left. Let's go implies that. Explain why they didn't go. Okay, So we have for all values are all real numbers X and all your number and wife where x be graded and go. And why has to be negative The difference of exercise Why has to be greater than the girl? Okay, you know, for C we have back there they're just someone that except to be less than or equal to build. And why have you estimated to go it alone? Uh, and also that different of x minus y about Bill. Okay, so this basically means just to non positive rule number. Who's different Deposited property. Where law for all life. Okay, we're party. We have for our and for all for all Rome numbers. Excellent. Why? Where? X and why cannot be zero. Ah, this is only a product of X and y. I cannot be so every word. This Yes, for every real number or to roll numbers there, the two real numbers are both No big moves. If only the product doesn't look for them, are not ***. Not until then, the product of both of them. It's also not Joe.

Because they're the same. A queue of X comma y is a student. Thanks. Has been a consistence on quiz show. Why? Okay, we have exes domain consistent all students at your school and one consistent of all ship quiz shows on television. Now for for a we have there's students. So there exists, um, ex at your school who has read the contestants on a television quiz show. So this is big this, um, ex exists. And why such? That's Q of X comma y home for part B. We have no student at your school. Okay, so I noticed no student at your school has ever been to a consistent oh has ever been a contestant contestant on the television question. So for all ex, for all Why a delegation of q X y hope apart. See, we have here is a student at the school who has been the contestant on jeopardy and on well, will a fortune. So that slip there's just some ex such sense hue of ex Jeopardy. And you, uh, ex well, gin holds good. No, we're working. We have every television. Quite a show has had a student from your school as a contestant. So this is this gonna be for, uh, television quiz shows? There exists? Um, student. So it's like you of that, Sona. Why holds reports we have that at least two students from your school husband. Contestants of Jeopardy. Okay, so there exists some X and then just, um, Why such That's used to our students. So X is not equal to why. And they have been in jeopardy so soon. Ex husband in jeopardy and also students, why has been in jeopardy.


Similar Solved Questions

5 answers
Two astronauts arc 00 m apart in thcir spaccship. Onc pcaks to thc othcr: The convcrsation is transmittcd to carth via clcctromagnctic wavcs Thc time it takes for sound waves t0 travel at 340 mls through the air hetween the astronauts equals the time it takes for the electromagnetic waves to travel thc carth: How far away from thc carth is thc spaccship?
Two astronauts arc 00 m apart in thcir spaccship. Onc pcaks to thc othcr: The convcrsation is transmittcd to carth via clcctromagnctic wavcs Thc time it takes for sound waves t0 travel at 340 mls through the air hetween the astronauts equals the time it takes for the electromagnetic waves to travel...
5 answers
When menthyl chloride undergoes Elimination via Ihe E2 pathway, forms only product: Show the mechanism , including Newman projection to indicate the stereochemistry, and the product that results.CH,HaCCH, Menthyl ChlorideHycCHaCH,HyC
When menthyl chloride undergoes Elimination via Ihe E2 pathway, forms only product: Show the mechanism , including Newman projection to indicate the stereochemistry, and the product that results. CH, HaC CH, Menthyl Chloride Hyc CHa CH, HyC...
5 answers
Question 90/4ptsBelow is the sequence of a DNA being transcribed What is the sequence of the polypeptides? Use one letter abbreviation for amino acid in your answer: DO NOT add a space better letter: For example; if your answer is "Lys-Lys- Lys" write it as "KKK"~TTTCCATTCATGTATTGTGCCACTGAAGCTACATCCTTTATCTCTCACTAAATT-3 ~AAAGGTAAGTACATAACACGGTGACTTCGATGTAGGAAATAGAGAGTGATTTAA-5
Question 9 0/4pts Below is the sequence of a DNA being transcribed What is the sequence of the polypeptides? Use one letter abbreviation for amino acid in your answer: DO NOT add a space better letter: For example; if your answer is "Lys-Lys- Lys" write it as "KKK" ~TTTCCATTCATGT...
5 answers
Year 78.70Population 7870 7870 1989 4 10887, eli 148,56 258.21 200095 20035 240024Population 33 2 19804 158056 2000,51980
Year 78.70 Population 7870 7870 1989 4 10887, eli 148,56 258.21 200095 20035 240024 Population 33 2 19804 158056 2000,5 1980...
4 answers
Compute the aplace transfom 2 2 elt ~ 2 'u(t a),t > 0
Compute the aplace transfom 2 2 elt ~ 2 'u(t a),t > 0...
5 answers
If f() = *2 Zx, evaluate [Lrtl)-IC
If f() = *2 Zx, evaluate [Lrtl)-IC...
5 answers
(26 pts ) Let T:P ~ R be defined by T(p(t)) = | p(t)dt Before doing any other parts of this problem, explain why T is or isn't an isomorphism: b. Prove T is linear Find a basis for the kernel of T: d. Use the Rank-Nullity equation to determine if T is onto. Explain your reasoning:
(26 pts ) Let T:P ~ R be defined by T(p(t)) = | p(t)dt Before doing any other parts of this problem, explain why T is or isn't an isomorphism: b. Prove T is linear Find a basis for the kernel of T: d. Use the Rank-Nullity equation to determine if T is onto. Explain your reasoning:...
5 answers
You are given the following dala: KaHCN = 6.2 x 10 -10 KaHF = 7.2 X 10-4 KaCH;COOH = 1.8 x 10-5 KaHOCN 2.0 x 10-4 What is [he pH of 0.28 M NaCN?
You are given the following dala: KaHCN = 6.2 x 10 -10 KaHF = 7.2 X 10-4 KaCH;COOH = 1.8 x 10-5 KaHOCN 2.0 x 10-4 What is [he pH of 0.28 M NaCN?...
5 answers
Four radioactive decay series are known $-$ three naturally occurring, and one beginning with the synthetic isotope ${ }_{94}^{241} mathrm{Pu}$. To which of these decay series does the isotope ${ }_{89}^{227} mathrm{Ac}$ belong? To which series does ${ }_{89}^{225}$ Ac belong? Each isotope in these series decays by either alpha emission or beta emission. How do these decay processes affect the mass number?
Four radioactive decay series are known $-$ three naturally occurring, and one beginning with the synthetic isotope ${ }_{94}^{241} mathrm{Pu}$. To which of these decay series does the isotope ${ }_{89}^{227} mathrm{Ac}$ belong? To which series does ${ }_{89}^{225}$ Ac belong? Each isotope in these ...
5 answers
Fill in the blank(s) to correctly complete each sentence. The graph of $f(x)=(x-7)^{2}$ is obtained by shifting the graph of $y=x^{2}$ to the 7 _____ units
Fill in the blank(s) to correctly complete each sentence. The graph of $f(x)=(x-7)^{2}$ is obtained by shifting the graph of $y=x^{2}$ to the 7 _____ units...
1 answers
Assume that you are interested in earning some return on idle balances you usually keep in your checking account and decide to buy some money market mutual funds shares by writing a check. Comment on the effect of your action (with everything else the same) on $\mathrm{M} 1$ and $\mathrm{M} 2$
Assume that you are interested in earning some return on idle balances you usually keep in your checking account and decide to buy some money market mutual funds shares by writing a check. Comment on the effect of your action (with everything else the same) on $\mathrm{M} 1$ and $\mathrm{M} 2$...
5 answers
What type of analysis is this?Tests ot Berween-Sublects Effects Drpendent Viqubk hil Teham Soutcs cotested Hadel 709588 886. 655 Fiergep 11065,774 3065.724 949.073 (x0m? J062.686 3062.686 25,708 74 14604 Joceol 114.836 769 #9echn 489,025 64 006 368 182797.26 695 Ie 1601809.00 704 Geueosdet! 29690.492 squJled 079 (ndjusted Squjira 066)Pantl E4 squlltd0oo079O0o 000 000036 024 00} 006For the toolbar press ALT-F1O (PC) or ALT+FN+FIO (Mac) B I 4 $ Paragraph Arial4px
What type of analysis is this? Tests ot Berween-Sublects Effects Drpendent Viqubk hil Teham Soutcs cotested Hadel 709588 886. 655 Fiergep 11065,774 3065.724 949.073 (x0m? J062.686 3062.686 25,708 74 14604 Joceol 114.836 769 #9echn 489,025 64 006 368 182797.26 695 Ie 1601809.00 704 Geueosdet! 29690.4...
5 answers
TRIGONOMETRIC IDENTITIES AND EQUATIONSFinding solutions in an interval for an equation with sine and.Find all solutions of the equation in the interval [0, 2t)~2 sinx+ cos2x=1Write your answer in radians in terms of T. If there is more than one solution, separate them with commas:JXExplanationCheck
TRIGONOMETRIC IDENTITIES AND EQUATIONS Finding solutions in an interval for an equation with sine and. Find all solutions of the equation in the interval [0, 2t) ~2 sinx+ cos2x=1 Write your answer in radians in terms of T. If there is more than one solution, separate them with commas: J X Explanatio...
5 answers
Determine the sample size needed t0 construct 90% confidence interval to estimate the population mean when 0 = 34 and the margin of error equals 5Click the con t0 view table of standard normab cumulative probabilities_(Round up to the nearest integer:)
Determine the sample size needed t0 construct 90% confidence interval to estimate the population mean when 0 = 34 and the margin of error equals 5 Click the con t0 view table of standard normab cumulative probabilities_ (Round up to the nearest integer:)...

-- 0.023159--