5

4.) Suppose=5a - 9 6 -h c-i 4A.)Find4B.)Find2d ~2e -2f3a 36 3c 4C.)Find...

Question

4.) Suppose=5a - 9 6 -h c-i 4A.)Find4B.)Find2d ~2e -2f3a 36 3c 4C.)Find

4.) Suppose =5 a - 9 6 -h c-i 4A.)Find 4B.)Find 2d ~2e -2f 3a 36 3c 4C.)Find



Answers

$$\frac{4(d+3)-9}{8}=\frac{10-(2-d)}{6}$$
In the equation above, what is the value of $d ?$
$$\begin{array}{l}{\text { (A) } \frac{23}{16}} \\ {\text { (B) } \frac{23}{8}} \\ {\text { (C) } \frac{25}{8}} \\ {\text { (D) } \frac{25}{4}}\end{array}$$

We need to divide the two fractions. So the first fraction we're gonna pull out of four and we have a plus three inside the parentheses. The denominator. We're gonna pull out of six and have a minus three inside. The parentheses are division is going to change to multiplication. The second fraction is going to flip, so the five a minus 15 is going to go on the top, So we're gonna pull out of five. We're left with a minus three inside the parentheses. The 38 plus nine goes to the bottom of the fraction we're gonna pull out of three, and we're left with a plus three. So we go ahead and cancel out what we can. Eight plus threes. Cancel out a minus threes. Cancel out. Then we have the six and the four share, too. So we're left with two and three. So when we multiply straight across, we have 10 on top, divided by nine. And that's our final answer.

In discussion we are given with do these two mattresses added and equal toe the third matrix so we can solve the allergies as the tumor traces are headed. Then the corresponding elements are being added. So v hell, the result off tumor traces addition has zero will be ready with negative nine. So there, minus nine four, are well buried with Aitor. So four R plus state are a taste of a very toe three so eight s plus three. Then we're six p with two. So six people's too do with five So two plus fire five with four So five plus full equals two do 36 207 20 seven. Well, a now we can give. And so for this addition as you get a zero to minus nine. Eight s plus three six p plus two plus 5 +75 plus four is nine equals two, 2 36 27 27 12 a. No. The dimension of this matrix is to cross three and also dismal. Texas to across three so we can compare the two mattresses and the tumor presents can be equal if and only if their corresponding elements are equal. So first we have first row for scholarly. Was there minus nine? And here we have two. So is there the minus nine equals Toto, This gives us Is there a question? 11. Next we have well, r equals to 36. So vo two LR equals 36. This gives us our quest to three. Next, we have eight s plus three equals to 27. So we can write. It is eight x plus three equals two 27. This gives us eight s equals to 27. Minus three is 24 which gives us s equals 23 Next to the hotel six p plus two equals to 20. Therefore six p equals 2 18 Hence the hell he was 23 Next to be held second or second column Element E seven here also seven. So both are same. And then second route Her column element is nine here to allay. So we have nine equals Student will A These employees a equals tau nine divided Vital which cancels to three divided by who Hence our answer will be given by zero equals 2 11 Our quest for three s equals 23 b equals 23 and a equals 23 divided by four dead goes over. Answer

So we know that the problem we need to figure out the congestion. So the parallel opposite sides congestion states that the opposite sides of a parallelogram are congruent, meaning that they are the same length. So in this case what we can do is let's just draw a parallelogram. Just that we have reference I was dropped everyone. Okay so now we are for a little again so graham. Okay fix it. You got parallelogram. So now let's start substituting. So the parallel opposite sides conjecture speeds that X. So we know this because X -3 is equal to 17. So now we can do the addition property equal to equality. So X minus three plus three is equal to 17 plus three. So that means if we simplify X is equal to 20. So now we need to find the perimeter of all the silence so the perimeter is equal to 17 plus x minus three Plus two, multiplied by X most plus three. So this is gonna be the some of the silence. So p we can also substitute this so P is equal to He is equal to 17 plus 20 minus three plus two, multiplied by 20 plus three. So if we simplify all this, this is going to equal P equals 80. So that means the answer to our problem is going to pee Equals 80, something like this in blue. So this is because of the sum of all the sides of sides, this is going to be due to substitution property. Mhm Yeah and then the last one is going to be because of simplifying. Mhm Yeah. And this P is equal to 80. That's your.

We need to divide the following fractions, so we're first going to factor. So the top fraction part of the fraction has foray in comments. So we pull out of four a and we're left with a minus one. The bottom part of the fraction we pull out of nine and we're left with a minus one. The division is gonna become a multiplication, and then we're gonna flip the second fraction so our A minus ones are going to cancel out and then r nine and R 12 share three in comments or that we're left with three and a four on top. That's all we can cancel out. So four and four becomes 16, 8 times a becomes a squared, divided by 15, and that is our final answer.


Similar Solved Questions

4 answers
NameSection:DataPatt [: Pocparation ofa Beers Lan Plot(blank)1) Volume of 0.002M NaSCN added; mLR0100I2) Initial [SCN ] of solution, M3) [EXScN) 7 M4) AbsorbanceUsing Excel, prepare Hinear plot of Abscrpticn (y) over [Fe(SCN) ] (r) using the abore dat Force ten intercept to zero by night-clicking on the best-fit line, selecting " Format trendline. and checking bor Jabeled "Set intercepl = 0.'Include copy ofyour Beer $ Law plct with Eleleea Tepor.
Name Section: Data Patt [: Pocparation ofa Beers Lan Plot (blank) 1) Volume of 0.002M NaSCN added; mL R0 100 I 2) Initial [SCN ] of solution, M 3) [EXScN) 7 M 4) Absorbance Using Excel, prepare Hinear plot of Abscrpticn (y) over [Fe(SCN) ] (r) using the abore dat Force ten intercept to zero by night...
5 answers
[-/10 Points]DETAILSLARCALC11 2.5.032.Find dyldx by implicit differentiation_ Then find the slope of the graph at the given point:X COs Y = 37
[-/10 Points] DETAILS LARCALC11 2.5.032. Find dyldx by implicit differentiation_ Then find the slope of the graph at the given point: X COs Y = 37...
4 answers
Determination of an Equilibrium ConstantPreparation of the Calibration Curve Concentration of Fe(NOs)} in 0.10 M HNO; solution 0OoZm Concentration of NaSCN in 0.10 M HNO; solution LOLM Flask NumberVolume of NaSCN, mL Solution Initial [SCN } M Equil. [FeNCS?+ 1M Percent T AbsorbanceOSoRLK
Determination of an Equilibrium Constant Preparation of the Calibration Curve Concentration of Fe(NOs)} in 0.10 M HNO; solution 0OoZm Concentration of NaSCN in 0.10 M HNO; solution LOLM Flask Number Volume of NaSCN, mL Solution Initial [SCN } M Equil. [FeNCS?+ 1M Percent T Absorbance OSo RLK...
5 answers
Np 8 7 7 5 5 FFfF= 444 { 4 444€ } 4 0 1 2 0 {{ € { 8 1 0 { 3 0f {{ 1 2 { # 1 {2 1 1: M } 0} 1 0 8 0 1 7 0 { 2 380 1 1 1 1 3 8 5 1 3 61 1 9 7 7 1 { 1 1 J 1 % 1 7 3 8 0 { 1 0} 1 1 3 3 38
Np 8 7 7 5 5 FFfF= 444 { 4 444€ } 4 0 1 2 0 {{ € { 8 1 0 { 3 0f {{ 1 2 { # 1 {2 1 1: M } 0} 1 0 8 0 1 7 0 { 2 380 1 1 1 1 3 8 5 1 3 61 1 9 7 7 1 { 1 1 J 1 % 1 7 3 8 0 { 1 0} 1 1 3 3 3 8...
5 answers
What is the $mathrm{pH}$ of a $0.50 mathrm{M}$ aqueous $mathrm{NaCN}$ solution? $mathrm{p} K_{b}$ of $mathrm{CN}^{-}$is $4.70$
What is the $mathrm{pH}$ of a $0.50 mathrm{M}$ aqueous $mathrm{NaCN}$ solution? $mathrm{p} K_{b}$ of $mathrm{CN}^{-}$is $4.70$...
5 answers
How many purines and pyrimidines purines are there in DNA equence of the pyrimidine following 20 nucleotide pairs? Show your calculations_CTTTACCGGGGATAAGATTA GAAATGGCCCCTATTCTAAT
How many purines and pyrimidines purines are there in DNA equence of the pyrimidine following 20 nucleotide pairs? Show your calculations_ CTTTACCGGGGATAAGATTA GAAATGGCCCCTATTCTAAT...
5 answers
What do research findings suggest about cultural differences in unrealistic optimism?
What do research findings suggest about cultural differences in unrealistic optimism?...
5 answers
QUESTION 1Evaluate the integral:Inx edydxO 2 9 1 2
QUESTION 1 Evaluate the integral: Inx edydx O 2 9 1 2...
5 answers
Repeat Problem $9-18$ using helium as the working fluid.
Repeat Problem $9-18$ using helium as the working fluid....
5 answers
Quaetlon 9Lec f() Jn6+21upbc' boundIuabtalut(otcinnnnuig (0 >oDlcmmaIno viguimtIJd uau Eun
Quaetlon 9 Lec f() Jn6+21 upbc' bound Iuabtalut (otcinnnnuig (0 >oDlcmmaIno viguimt IJd uau Eun...
5 answers
Anj iA+vaL bf_Convtle fw teleivb the PowzlI_5licsKx_Cto CcC at b Ead L GLuiL fAz Sin
Anj iA+vaL bf_Convtle fw teleivb the PowzlI_5lics Kx_Cto CcC at b Ead L GLuiL fAz Sin...
4 answers
Writing all the relevant resonant structures and that of thehybrid ofresonance, propose a mechanism that explains why theresonanceMethyl benzoate is nitrated in the meta position. (5)
Writing all the relevant resonant structures and that of the hybrid of resonance, propose a mechanism that explains why the resonance Methyl benzoate is nitrated in the meta position. (5)...
5 answers
Question 3 (1 point) How many grams of water can be produced when 23.50 g of zinc oxide react with 35.11 g of hydrochloric acid? ZnO + 2HCI ZnClz + H2O
Question 3 (1 point) How many grams of water can be produced when 23.50 g of zinc oxide react with 35.11 g of hydrochloric acid? ZnO + 2HCI ZnClz + H2O...
2 answers
(10 points= For each of the following; carefully determine whether the series converges or notA. convergesB. diverges(b)A. convergesB. divergesA. convergesB. divergesVn"40n? convergesB. diverges
(10 points= For each of the following; carefully determine whether the series converges or not A. converges B. diverges (b) A. converges B. diverges A. converges B. diverges Vn"40n? converges B. diverges...

-- 0.021930--